Stem-loop sequence ath-MIR399d

AccessionMI0001023 (change log)
DescriptionArabidopsis thaliana miR399d stem-loop
Gene family MIPF0000015; MIR399
Literature search

37 open access papers mention ath-MIR399d
(200 sentences)

Stem-loop
     u      a u        a     a       -uc     -----g  ua 
5' gg uggauu c gggcgaau cuccu uggcaga   gcauu      gc  g
   || |||||| | |||||||| ||||| |||||||   |||||      ||  a
3' cc acuuaa g cccguuua gagga accgucu   cguaa      cg  u
     u      c c        -     a       cuu     aaugaa  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 14442978-14443077 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR399d
ath-MIR399fchr2: 14444997-14445114 [+]
ath-MIR399echr2: 14443504-14443612 [+]
ath-MIR399dchr2: 14442978-14443077 [-]
Database links

Mature sequence ath-miR399d

Accession MIMAT0000954
Sequence

70 - 

ugccaaaggagauuugccccg

 - 90

Get sequence
Evidence experimental; PCR [1], 5'RACE [2], 454 [3-4], MPSS [3], Illumina [5]

References

1
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).