Stem-loop sequence ath-MIR399d

Accession

MI0001023

Description

Arabidopsis thaliana miR399d stem-loop

Gene family

MIPF0000015; MIR399

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-399_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter. The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence.

Stem-loop

  u      a u        a     a       -uc     -----g  ua 
gg uggauu c gggcgaau cuccu uggcaga   gcauu      gc  g
|| |||||| | |||||||| ||||| |||||||   |||||      ||  a
cc acuuaa g cccguuua gagga accgucu   cguaa      cg  u
  u      c c        -     a       cuu     aaugaa  ua 

Deep sequencing

1946 reads, 7 experiments

Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context

• Coordinates (TAIR10): chr2: 14442978-14443077 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from ath-MIR399d

• ath-MIR399f: chr2: 14444997-14445114 [+]
• ath-MIR399e: chr2: 14443504-14443612 [+]
• ath-MIR399d: chr2: 14442978-14443077 [-]

Mature sequence ath-miR399d

• Accession: MIMAT0000954
• Sequence: 70 - ugccaaaggagauuugccccg - 90
• Deep sequencing: 1946 reads, 7 experiments
• Evidence: experimental; PCR [1], 5'RACE [2], 454 [3-4], MPSS [3], Solexa [5]

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3. PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4. PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5. PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).