|
miRBase |
|
Stem-loop sequence ath-MIR399c |
|||||
| Accession | MI0001022 | ||||
| Description | Arabidopsis thaliana miR399c stem-loop | ||||
| Gene family | MIPF0000015; MIR399 | ||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled mir-399_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter. The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence. |
||||
| Stem-loop |
a u a c u uuu aucuuuu ggagcagu auagggca cuuucu uuggcagg gac uggcua gu g |||||||| |||||||| |||||| |||||||| ||| |||||| || cuucguca ugucccgu gagagg aaccguuc cug aucggu ca u c u a a u uau guucuug |
||||
| Deep sequencing |
| ||||
| Comments |
This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1]. |
||||
| Genome context |
|
||||
Mature sequence ath-miR399c |
|
| Accession | MIMAT0000953 |
| Sequence |
84 - ugccaaaggagaguugcccug - 104 |
| Deep sequencing | 2184 reads, 7 experiments |
| Evidence | experimental; PCR [1], cloned [2], 5'RACE [3], 454 [4-5], MPSS [4], Solexa [6] |
References |
|
| 1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
| 2 |
PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"
Plant Cell. 16:2001-2019(2004).
|
| 3 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
| 4 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
| 5 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
| 6 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|