Stem-loop sequence ath-MIR399a

Accession

MI0001020

Description

Arabidopsis thaliana miR399a stem-loop

Gene family

MIPF0000015; MIR399

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-399_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter. The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence.

Stem-loop

aaau c           a       a        a   -     c     -u uu     cu 
    g auuacagggua gaucucu uuggcagg aac cauua uuaga  c  ugcau  c
    | ||||||||||| ||||||| |||||||| ||| ||||| |||||  |  |||||   
    c uaaugucccgu uuagagg aaccgucu uug gugau aauuu  g  acgua  u
ucuu u           -       a        a   a     u     uc uu     uu 

Deep sequencing

2038 reads, 7 experiments

Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context

• Coordinates (TAIR10): chr1: 10227073-10227195 [+]
• Overlapping transcripts:

  intergenic

Mature sequence ath-miR399a

• Accession: MIMAT0000951
• Sequence: 93 - ugccaaaggagauuugcccug - 113
• Deep sequencing: 2037 reads, 7 experiments
• Evidence: experimental; PCR [1], 454 [2-3], MPSS [2], Solexa [4]

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
3. PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
4. PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).