Stem-loop sequence ath-MIR398b

AccessionMI0001018 (change log)
DescriptionArabidopsis thaliana miR398b stem-loop
Gene family MIPF0000107; MIR398
Literature search

28 open access papers mention ath-MIR398b
(152 sentences)

Stem-loop
   u   u    a     u    a          c   u   caac       ---        
5'  gga cucg caggg ugau ugagaacaca gag aau    ggcugua   augacgc 
    ||| |||| ||||| |||| |||||||||| ||| |||    |||||||   |||||| u
3'  ucu gagu guccc acug acucuugugu cuu uug    ucgacau   uacugca 
   u   c    c     c    g          a   -   -cuc       ugu        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR398 family of miRNAs, which are predicted to target mRNAs coding for copper superoxide dismutases and cytochrome C oxidase subunit V [1].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 4691022-4691137 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR398b
ath-MIR398bchr5: 4691022-4691137 [+]
ath-MIR398cchr5: 4694694-4694808 [+]
Database links

Mature sequence ath-miR398b-5p

Accession MIMAT0031911
Sequence

12 - 

aggguugauaugagaacacac

 - 32

Get sequence
Evidence not experimental

Mature sequence ath-miR398b-3p

Accession MIMAT0000949
Previous IDsath-miR398b
Sequence

86 - 

uguguucucaggucaccccug

 - 106

Get sequence
Evidence experimental; 5'RACE [1], Northern [1-2], PCR [1], cloned [2-3], 3'RACE [3], 454 [4-5], MPSS [4]

References

1
2
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).