Stem-loop sequence ath-MIR396b

AccessionMI0001014 (change log)
DescriptionArabidopsis thaliana miR396b stem-loop
Gene family MIPF0000047; MIR396
Literature search

26 open access papers mention ath-MIR396b
(259 sentences)

Stem-loop
   g     ac                   a     uuuuucauuuccauuguuuuuuucuuaaacaaa 
5'  gucau  uuuuccacagcuuucuuga cuuuc                                 a
    |||||  ||||||||||||||||||| |||||                                 g
3'  cagua  aaagggugucgaaagaacu gaagg                                 u
   a     ca                   c     uuuuacgaauuagaauuucaaaaaaaagaagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR396 family of miRNAs, which are predicted to target mRNAs coding for Growth Regulating Factor (GRF) transcription factors, rhodenase-like proteins, and kinesin-like protein B [1]. The mature sequence reported in [2] is offset by 1 nt with respect to the sequence shown here.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 13611798-13611932 [+]
intergenic
Database links

Mature sequence ath-miR396b-5p

Accession MIMAT0000945
Previous IDsath-miR396b
Sequence

11 - 

uuccacagcuuucuugaacuu

 - 31

Get sequence
Evidence experimental; 5'RACE [1], Northern [1-2], PCR [1], 454 [3], MPSS [3]

Mature sequence ath-miR396b-3p

Accession MIMAT0031909
Sequence

107 - 

gcucaagaaagcugugggaaa

 - 127

Get sequence
Evidence not experimental

References

1
2
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).