Stem-loop sequence ath-MIR396b

Accession MI0001014
Description Arabidopsis thaliana miR396b stem-loop
Gene family MIPF0000047; MIR396
Stem-loop 
g     ac                   a     uuuuucauuuccauuguuuuuuucuuaaacaaa 
 gucau  uuuuccacagcuuucuuga cuuuc                                 a
 |||||  ||||||||||||||||||| |||||                                 g
 cagua  aaagggugucgaaagaacu gaagg                                 u
a     ca                   c     uuuuacgaauuagaauuucaaaaaaaagaagaa
Get sequence
Deep sequencing
3193 reads, 8 experiments
Comments

This sequence belongs to the miR396 family of miRNAs, which are predicted to target mRNAs coding for Growth Regulating Factor (GRF) transcription factors, rhodenase-like proteins, and kinesin-like protein B [1]. The mature sequence reported in [2] is offset by 1 nt with respect to the sequence shown here.

Genome context
Coordinates (TAIR10) Overlapping transcripts
chr5: 13611798-13611932 [+]
intergenic

Mature sequence ath-miR396b

Accession MIMAT0000945
Sequence

11 -  

uuccacagcuuucuugaacuu

 - 31

Get sequence
Deep sequencing 3017 reads, 8 experiments
Evidence experimental; 5'RACE [1], Northern [1-2], PCR [1], 454 [3], MPSS [3]
Validated targets

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).