Stem-loop sequence ath-MIR395e

AccessionMI0001011 (change log)
DescriptionArabidopsis thaliana miR395e stem-loop
Gene family MIPF0000016; MIR395
Literature search

25 open access papers mention ath-MIR395e
(106 sentences)

Stem-loop
   auguuu   -a         ug         u      u  a     u 
5'       ucu  gaguuccuc  agcacuuca uggaga ac auuuu u
         |||  |||||||||  ||||||||| |||||| || |||||  
3'       ggg  cucaagggg  uugugaagu aucuuu ug uaaaa a
   -uaguc   cc         gu         c      -  a     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 26272776-26272870 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR395e
ath-MIR395fchr1: 26273858-26273969 [+]
ath-MIR395echr1: 26272776-26272870 [-]
ath-MIR395dchr1: 26269979-26270078 [-]
Database links

Mature sequence ath-miR395e

Accession MIMAT0000942
Sequence

65 - 

cugaaguguuugggggaacuc

 - 85

Get sequence
Evidence experimental; 5'RACE [1-2], Northern [1], PCR [1], MPSS [3], 454 [4], Illumina [5]

References

1
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).