Stem-loop sequence ath-MIR395d

Accession

MI0001010

Description

Arabidopsis thaliana miR395d stem-loop

Gene family

MIPF0000016; MIR395

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-395_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-395 is a non-coding RNA called a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-395 is thought to target mRNAs coding for ATP sulphurylases. The mature sequence is excised from the 3' arm of the hairpin. miR-395 is upregulated in Arabidopsis during sulphate-limited conditions, when the mature miRNA then regulates sulphur transporters and ATP sulphurylases.

Stem-loop

   u c  ua         ug         u     --au      uuca 
aug c uc  gaguucucc  aacacuuca uggaa    uuguua    g
||| | ||  |||||||||  ||||||||| |||||    ||||||     
uac g ag  cucaagggg  uugugaagu accuu    gacaau    u
   u u  cc         gu         c     aauu      cgaa 

Deep sequencing

694 reads, 7 experiments

Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1].

Genome context

• Coordinates (TAIR10): chr1: 26269979-26270078 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from ath-MIR395d

• ath-MIR395f: chr1: 26273858-26273969 [+]
• ath-MIR395e: chr1: 26272776-26272870 [-]
• ath-MIR395d: chr1: 26269979-26270078 [-]

Mature sequence ath-miR395d

• Accession: MIMAT0000941
• Sequence: 70 - cugaaguguuugggggaacuc - 90
• Deep sequencing: 694 reads, 7 experiments
• Evidence: experimental; 5'RACE [1], Northern [1], PCR [1], MPSS [2], 454 [3], Solexa [4]

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
3. PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
4. PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).