![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR393b |
|||||
Accession | MI0001004 (change log) | ||||
Description | Arabidopsis thaliana miR393b stem-loop | ||||
Gene family | MIPF0000083; MIR393 | ||||
Literature search |
![]()
31 open access papers mention ath-MIR393b | ||||
Stem-loop |
a u ---u u ugauuuauuccccaauaauuguuuuuuuuuuccuucu 5' agagaa ggauccaaagggaucgcau gaucc aa uaagc c |||||| ||||||||||||||||||| ||||| || ||||| 3' uuucuu cuuagguuucucuagcgua cuagg uu auucg a a - ccuu c uuuuacaaaccuuaaacaaaaagaagguagaaagcua |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence belongs to the miR393 family of miRNAs, which are predicted to target mRNAs coding for F-box proteins and bHLH transcription factors [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR393b-3p |
|
Accession | MIMAT0031906 |
Sequence |
132 - aucaugcgaucucuuuggauu - 152 |
Evidence | experimental; Illumina [5] |
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"
Plant Cell. 16:2001-2019(2004).
|
3 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
4 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
5 |
PMID:24119003
"Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"
BMC Genomics. 14:701(2013).
|