Stem-loop sequence ath-MIR393b

Accession MI0001004
Description Arabidopsis thaliana miR393b stem-loop
Gene family MIPF0000083; MIR393
Stem-loop 
      a                   u     ---u  u     ugauuuauuccccaauaauuguuuuuuuuuuccuucu 
agagaa ggauccaaagggaucgcau gaucc    aa uaagc                                     c
|||||| ||||||||||||||||||| |||||    || |||||                                      
uuucuu cuuagguuucucuagcgua cuagg    uu auucg                                     a
      a                   -     ccuu  c     uuuuacaaaccuuaaacaaaaagaagguagaaagcua
Get sequence
Deep sequencing
937 reads, 7 experiments
Comments

This sequence belongs to the miR393 family of miRNAs, which are predicted to target mRNAs coding for F-box proteins and bHLH transcription factors [1].

Genome context
Coordinates (TAIR10) Overlapping transcripts
chr3: 20691647-20691806 [+]
intergenic

Mature sequence ath-miR393b

Accession MIMAT0000935
Sequence

11 -  

uccaaagggaucgcauugaucc

 - 32

Get sequence
Deep sequencing 120 reads, 7 experiments
Evidence experimental; 5'RACE [1], Northern [1-2], PCR [1], cloned [2], 454 [3], MPSS [3-4]

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).