Stem-loop sequence ath-MIR393b

AccessionMI0001004 (change log)
DescriptionArabidopsis thaliana miR393b stem-loop
Gene family MIPF0000083; MIR393
Literature search

31 open access papers mention ath-MIR393b
(79 sentences)

Stem-loop
         a                   u     ---u  u     ugauuuauuccccaauaauuguuuuuuuuuuccuucu 
5' agagaa ggauccaaagggaucgcau gaucc    aa uaagc                                     c
   |||||| ||||||||||||||||||| |||||    || |||||                                      
3' uuucuu cuuagguuucucuagcgua cuagg    uu auucg                                     a
         a                   -     ccuu  c     uuuuacaaaccuuaaacaaaaagaagguagaaagcua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR393 family of miRNAs, which are predicted to target mRNAs coding for F-box proteins and bHLH transcription factors [1].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 20691647-20691806 [+]
intergenic
Database links

Mature sequence ath-miR393b-5p

Accession MIMAT0000935
Previous IDsath-miR393b
Sequence

11 - 

uccaaagggaucgcauugaucc

 - 32

Get sequence
Evidence experimental; 5'RACE [1], Northern [1-2], PCR [1], cloned [2], 454 [3], MPSS [3-4]

Mature sequence ath-miR393b-3p

Accession MIMAT0031906
Sequence

132 - 

aucaugcgaucucuuuggauu

 - 152

Get sequence
Evidence experimental; Illumina [5]

References

1
2
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:24119003 "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots" Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA BMC Genomics. 14:701(2013).