Stem-loop sequence ath-MIR393a

AccessionMI0001003 (change log)
DescriptionArabidopsis thaliana miR393a stem-loop
Gene family MIPF0000083; MIR393
Literature search

32 open access papers mention ath-MIR393a
(88 sentences)

Stem-loop
   a     a              c    u     -u     aggugaauucuccccauauuuucuuua 
5'  gagga ggauccaaagggau gcau gaucc  aauua                           u
    ||||| |||||||||||||| |||| |||||  |||||                           a
3'  uuccu cuuagguuucucua cgua cuagg  uuggu                           a
   c     a              u    -     uu     ucguuuaaaaacacuaaauaaacgguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR393 family of miRNAs, which are predicted to target mRNAs coding for F-box proteins and bHLH transcription factors [1].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 16652101-16652233 [+]
intergenic
Database links

Mature sequence ath-miR393a-5p

Accession MIMAT0000934
Previous IDsath-miR393a
Sequence

11 - 

uccaaagggaucgcauugaucc

 - 32

Get sequence
Evidence experimental; 5'RACE [1], Northern [1,3], PCR [1], cloned [2], 454 [4], MPSS [4-5]

Mature sequence ath-miR393a-3p

Accession MIMAT0031905
Sequence

105 - 

aucaugcuaucucuuuggauu

 - 125

Get sequence
Evidence not experimental

References

1
2
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
3
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).