Stem-loop sequence ath-MIR391

AccessionMI0001002 (change log)
DescriptionArabidopsis thaliana miR391 stem-loop
Gene family MIPF0001151; MIR391
Literature search

3 open access papers mention ath-MIR391
(6 sentences)

Stem-loop
       --       cacau    g   ----     cu   u  a g  u    aac    a   -   au     u  c          g  c      -----cu      
5' uaga  gugauua     acaa ugg    ucuug  ucu cu u gu uuaa   ugca aua aag  uugcu cg aggagagaua cg caucac       cuucu 
   ||||  |||||||     |||| |||    |||||  ||| || | || ||||   |||| ||| |||  ||||| || |||||||||| || ||||||       |||| a
3' aucu  cacuaau     uguu acu    ggaac  aga ga g ca aauu   acgu uau uuc  aacga gc uccucucuau gc guggug       gaaga 
       cc       -aacu    g   uuau     -u   -  - g  u    -cu    a   a   cu     u  a          g  a      aucaauu      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 24293093-24293298 [+]
intergenic
Database links

Mature sequence ath-miR391-5p

Accession MIMAT0000933
Previous IDsath-miR391
Sequence

68 - 

uucgcaggagagauagcgcca

 - 88

Get sequence
Evidence experimental; cloned [1], 454 [2], Northern [2], Illumina [3]

Mature sequence ath-miR391-3p

Accession MIMAT0031904
Sequence

119 - 

acgguaucucuccuacguagc

 - 139

Get sequence
Evidence not experimental

References

1
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
2
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
3
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).