Stem-loop sequence ath-MIR390b

AccessionMI0001001 (change log)
DescriptionArabidopsis thaliana miR390b stem-loop
Gene family MIPF0000101; MIR390
Literature search

34 open access papers mention ath-MIR390b
(119 sentences)

Stem-loop
        au      aa         g           uggcucaccagugcuguauguuu 
5' gagaa  agcuau  agcucagga ggauagcgcca                       u
   |||||  ||||||  ||||||||| |||||||||||                        
3' uucuu  ucgaua  uugaguccu ccuaucgcggu                       g
        cu      cc         a           ugucuauauguacaugcguauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR390 was independently cloned by the ASRP project [1], and predicted by computational methods [2].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 23636947-23637066 [+]
intergenic
Database links

Mature sequence ath-miR390b-5p

Accession MIMAT0000932
Previous IDsath-miR390b
Sequence

15 - 

aagcucaggagggauagcgcc

 - 35

Get sequence
Evidence experimental; cloned [1,3], 454 [4-5], MPSS [4], Illumina [6]

Mature sequence ath-miR390b-3p

Accession MIMAT0031903
Sequence

88 - 

cgcuauccauccugaguucc

 - 107

Get sequence
Evidence not experimental

References

1
PMID:15608278 "ASRP: the Arabidopsis Small RNA Project Database" Gustafson AM, Allen E, Givan S, Smith D, Carrington JC, Kasschau KD Nucleic Acids Res. 33:D637-D640(2005).
2
PMID:15632092 "Computational prediction of miRNAs in Arabidopsis thaliana" Adai A, Johnson C, Mlotshwa S, Archer-Evans S, Manocha V, Vance V, Sundaresan V Genome Res. 15:78-91(2005).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).