Stem-loop sequence ath-MIR171b

AccessionMI0000989 (change log)
DescriptionArabidopsis thaliana miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

28 open access papers mention ath-MIR171b
(123 sentences)

Stem-loop
   -----ugcaa   --aa    a      a ug          a     --    c    uaa 
5'           ggu    cgcg gauauu g  cgguucaauc aauag  ucgu cucu   c
             |||    |||| |||||| |  |||||||||| |||||  |||| ||||    
3'           cca    gcgc cuauaa c  gccgaguuag uuguu  ggca gagg   u
   acgguaaaaa   aaug    a      c gu          c     gu    a    uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors. Its expression in Arabidopsis was confirmed by cloning and Northern blot [2,3]. The mature sequence reported in [3] is offset by 4 nts with respect to the sequence shown here.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 3961348-3961464 [-]
intergenic
Database links

Mature sequence ath-miR171b-5p

Accession MIMAT0031899
Sequence

15 - 

agauauuagugcgguucaauc

 - 35

Get sequence
Evidence not experimental

Mature sequence ath-miR171b-3p

Accession MIMAT0000920
Previous IDsath-miR171b
Sequence

78 - 

uugagccgugccaauaucacg

 - 98

Get sequence
Evidence experimental; cloned [2,4], Northern [2-3], 5'RACE [4], 454 [5-6], MPSS [5]

References

1
2
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
3
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
4
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
5
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
6
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).