|
miRBase |
|
Stem-loop sequence ath-MIR169n |
||||||||||||||
| Accession | MI0000988 | |||||||||||||
| Description | Arabidopsis thaliana miR169n stem-loop | |||||||||||||
| Gene family | MIPF0000012; MIR169_1 | |||||||||||||
| Stem-loop |
gaugaagaagagaggucuaacauggcggaaagcgucauguuua u u -u uuuc c c uuucaaauu cau ga cuu guagccaagga gacu gccuga cuu gccu ca gauucaa caug uuug uuauuauac u ||||||||||| |||| |||||| ||| |||| || ||||||| |||| |||| ||||||||| uaucgguuucu cuga cggacu gga uggg gu cuaaguu guac aaac gauaauaug u --------------------uaccuaccuuuuucguacaguuc - - uu ---u c u --------- uau ug aaa |
|||||||||||||
| Deep sequencing |
| |||||||||||||
| Comments |
This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [2]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors. |
|||||||||||||
| Genome context |
|
|||||||||||||
| Clustered miRNAs |
|
|||||||||||||
Mature sequence ath-miR169n |
|
| Accession | MIMAT0000919 |
| Sequence |
45 - uagccaaggaugacuugccug - 65 |
| Deep sequencing | 2115 reads, 8 experiments |
| Evidence | experimental; 5'RACE [2], cloned [2], 454 [3-4], MPSS [3], Solexa [5] |
References |
|
| 1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
| 2 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
| 3 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
| 4 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
| 5 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|