Stem-loop sequence ath-MIR169m

AccessionMI0000987 (change log)
DescriptionArabidopsis thaliana miR169m stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

34 open access papers mention ath-MIR169m
(159 sentences)

Stem-loop
   ua     -   a   aa      -au       u     uu  -          u    u     -uu    ----            guuagug    -      caa     u 
5'   gaagg aga guc  agauga   agaagaa cauau  gg uagccaagga gacu gccug   ucuu    ugaguaaaaugg       ucau guuuga   gugac a
     ||||| ||| |||  ||||||   ||||||| |||||  || |||||||||| |||| |||||   ||||    ||||||||||||       |||| ||||||   ||||| u
3'   cuucc uuu cag  ucuacu   ucuucuu guaua  cc aucgguuccu cuga cggac   agaa    acucauuuuacc       agua cgaacu   uauug a
   ua     a   g   ac      cuc       -     uu  u          -    -     uac    aacu            -------    a      --a     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [2]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 9878168-9878379 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR169m
ath-MIR169nchr3: 9878540-9878754 [-]
ath-MIR169mchr3: 9878168-9878379 [-]
ath-MIR169lchr3: 9875893-9876103 [-]
ath-MIR169kchr3: 9875525-9875737 [-]
ath-MIR169jchr3: 9872333-9872553 [-]
ath-MIR169ichr3: 9871960-9872165 [-]
Database links

Mature sequence ath-miR169m

Accession MIMAT0000918
Sequence

42 - 

uagccaaggaugacuugccug

 - 62

Get sequence
Evidence experimental; cloned [2], 454 [3-4], MPSS [3], Illumina [5]

References

1
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).