Stem-loop sequence ath-MIR169l

AccessionMI0000986 (change log)
DescriptionArabidopsis thaliana miR169l stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

34 open access papers mention ath-MIR169l
(157 sentences)

Stem-loop
   augaagaagagaggucuaauauggcgaaaagagucauguuua           u    u      -u   uuuc    c  u        uuuaaguucgug     ug           g u 
5'                                           auagccaagga gacu gccuga  cuu    accu ca gauucaau            gauuu  gauuauuaugc u u
                                             ||||||||||| |||| ||||||  |||    |||| || ||||||||            |||||  ||||||||||| | a
3'                                           uaucgguuucu cuga cggacu  gga    uggg gu cuaaguug            cuaga  uuaauaauaug a a
   ----------------------cuacuucuuucguacaguuc           -    -      uu   ---u    c  u        ----------ua     gu           g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [2]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 9875893-9876103 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR169l
ath-MIR169nchr3: 9878540-9878754 [-]
ath-MIR169mchr3: 9878168-9878379 [-]
ath-MIR169lchr3: 9875893-9876103 [-]
ath-MIR169kchr3: 9875525-9875737 [-]
ath-MIR169jchr3: 9872333-9872553 [-]
ath-MIR169ichr3: 9871960-9872165 [-]
Database links

Mature sequence ath-miR169l

Accession MIMAT0000917
Sequence

44 - 

uagccaaggaugacuugccug

 - 64

Get sequence
Evidence experimental; 5'RACE [2], cloned [2], 454 [3-4], MPSS [3], Illumina [5]

References

1
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).