Stem-loop sequence ath-MIR169i

Accession MI0000983
Description Arabidopsis thaliana miR169i stem-loop
Gene family MIPF0000012; MIR169_1
Stem-loop 
     -a      aa       -u       u     uu  -          u    u      -c     -----gu        uuuagugucuuguuugaaguca 
gaagg  gauguc  agaugaa  agaagaa cauau  gg uagccaagga gacu gccuga  ucuuu       guaaaaug                      c
|||||  ||||||  |||||||  ||||||| |||||  || |||||||||| |||| ||||||  |||||       ||||||||                       
cuucc  uuacag  ucuacuu  ucuucuu guaua  cc aucgguuccu cuga cggacu  agaaa       cguuuuac                      u
     ac      ac       uc       -     uu  u          -    -      au     aaauauu        caguaacgaacuauguugaaua
Get sequence
Deep sequencing
2160 reads, 8 experiments
Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [2]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context
Coordinates (TAIR10) Overlapping transcripts
chr3: 9871960-9872165 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR169i
ath-MIR169n chr3: 9878540-9878754 [-]
ath-MIR169m chr3: 9878168-9878379 [-]
ath-MIR169l chr3: 9875893-9876103 [-]
ath-MIR169k chr3: 9875525-9875737 [-]
ath-MIR169j chr3: 9872333-9872553 [-]
ath-MIR169i chr3: 9871960-9872165 [-]

Mature sequence ath-miR169i

Accession MIMAT0000914
Sequence

40 -  

uagccaaggaugacuugccug

 - 60

Get sequence
Deep sequencing 2113 reads, 8 experiments
Evidence experimental; cloned [2], 454 [3-4], MPSS [3], Solexa [5]

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).