Stem-loop sequence ath-MIR169g

AccessionMI0000981 (change log)
DescriptionArabidopsis thaliana miR169g stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

35 open access papers mention ath-MIR169g
(160 sentences)

Stem-loop
   -ugccuauaaauaccuucaucacgaguaugacaagaucac   a       -agaaaggu       -    ga      ------------         ----      g  ucucuaguu     aga      u    --      au      u    uu         a            uuuuuu     au     uaa 
5'                                         aag caagaaa         agagaaa acau  uaauga            ugauuacga    ugauga ag         guauc   gggucu gcau  ggaaga  agagaa gagg  gagccaagg ugacuugccggg      uacca  gaauc   u
                                           ||| |||||||         ||||||| ||||  ||||||            |||||||||    |||||| ||         |||||   |||||| ||||  ||||||  |||||| ||||  ||||||||| ||||||||||||      |||||  |||||   u
3'                                         uuc guuuuuu         ucuuuuu ugua  guuacu            acuagugcu    acuacu uc         uauag   cucaga ugua  uuuucu  ucucuu cuuu  cucgguucc guugaacggccu      guggu  cuuag   a
   acguuuuuguuuuuagacuaguaaguuuagcuuuuuggca   g       aagcguagu       g    aa      uuaauguuucaa         aagu      a  ---------     aac      c    gg      --      c    gu         a            ------     --     uca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [3,4]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors. Wang et al. report Northern blot evidence for the miR169* sequence from the opposite arm of the precursor [2].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 11482879-11483257 [-]
intergenic
Database links

Mature sequence ath-miR169g-5p

Accession MIMAT0000911
Previous IDsath-miR169g
Sequence

144 - 

ugagccaaggaugacuugccg

 - 164

Get sequence
Evidence experimental; cloned [3], 454 [4-5], MPSS [4], Illumina [6]

Mature sequence ath-miR169g-3p

Accession MIMAT0000912
Previous IDsath-miR169g*
Sequence

204 - 

uccggcaaguugaccuuggcu

 - 224

Get sequence
Evidence experimental; Northern [2], 454 [5]

References

1
2
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).