Stem-loop sequence mmu-mir-215

AccessionMI0000974 (change log)
Symbol MGI:Mir215
DescriptionMus musculus miR-215 stem-loop
Gene family MIPF0000063; mir-192
Literature search

29 open access papers mention mmu-mir-215
(275 sentences)

Stem-loop
   agcucuc    ucaac  ug       gaa  a     -  uu        c     g 
5'        agca     gg  uacagga   ug ccuau ga  ugacagac gugca c
          ||||     ||  |||||||   || ||||| ||  |||||||| |||||  
3'        ucgu     cu  augucuu   ac ggaug cu  acugucug uaugu u
   aaauuca    ---ca  gu       aua  c     u  -u        -     g 
Get sequence
Deep sequencing
266573 reads, 913 reads per million, 103 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This mouse miRNA was predicted by computational methods using conservation with human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The 3' end was not experimentally determined. The mature sequence differs from the human miR-215 at A12->U, and its expression has not been verified in mouse.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 185313581-185313692 [+]
antisense
OTTMUST00000051852 ; Iars2-001; intron 12
OTTMUST00000051855 ; Iars2-004; intron 12
OTTMUST00000051856 ; Iars2-005; intron 12
ENSMUST00000027921 ; Iars2-001; intron 12
ENSMUST00000110975 ; Iars2-005; intron 12
ENSMUST00000110974 ; Iars2-004; intron 12
Clustered miRNAs
< 10kb from mmu-mir-215
mmu-mir-194-1chr1: 185313319-185313385 [+]
mmu-mir-215chr1: 185313581-185313692 [+]
Database links

Mature sequence mmu-miR-215-5p

Accession MIMAT0000904
Previous IDsmmu-miR-215
Sequence

30 - 

augaccuaugauuugacagac

 - 50

Get sequence
Deep sequencing266410 reads, 103 experiments
Evidence experimental; Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-215-3p

Accession MIMAT0017169
Previous IDsmmu-miR-215*
Sequence

67 - 

ucugucauucuguaggccaau

 - 87

Get sequence
Deep sequencing160 reads, 14 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).