Stem-loop sequence rno-mir-320

AccessionMI0000972 (change log)
DescriptionRattus norvegicus miR-320 stem-loop
Gene family MIPF0000163; mir-320
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-320. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-320 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   gc    c      ---c         uu       c      g 
5'   cucg uguccu    cgccuucuc  cccgguu uucccg a
     |||| ||||||    |||||||||  ||||||| ||||||  
3'   gggu auagga    gcgggagag  gggucga aagggc g
   --    -      aaaa         uu       a      u 
Get sequence
Deep sequencing
22711 reads, 82.1 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr15: 52134276-52134357 [+]
intergenic
Database links

Mature sequence rno-miR-320-5p

Accession MIMAT0017168
Previous IDsrno-miR-320*
Sequence

16 - 

gccuucucuucccgguucuucc

 - 37

Get sequence
Deep sequencing51 reads, 15 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-320-3p

Accession MIMAT0000903
Previous IDsrno-miR-320
Sequence

48 - 

aaaagcuggguugagagggcga

 - 69

Get sequence
Deep sequencing22518 reads, 39 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).