Stem-loop sequence rno-mir-320

AccessionMI0000972 (change log)
DescriptionRattus norvegicus miR-320 stem-loop
Gene family MIPF0000163; mir-320
Literature search

37 open access papers mention rno-mir-320
(266 sentences)

Stem-loop
   gc    c      ---c         uu       c      g 
5'   cucg uguccu    cgccuucuc  cccgguu uucccg a
     |||| ||||||    |||||||||  ||||||| ||||||  
3'   gggu auagga    gcgggagag  gggucga aagggc g
   --    -      aaaa         uu       a      u 
Get sequence
Deep sequencing
241785 reads, 513 reads per million, 510 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr15: 52134276-52134357 [+]
intergenic
Database links

Mature sequence rno-miR-320-5p

Accession MIMAT0017168
Previous IDsrno-miR-320*
Sequence

16 - 

gccuucucuucccgguucuucc

 - 37

Get sequence
Deep sequencing739 reads, 187 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-320-3p

Accession MIMAT0000903
Previous IDsrno-miR-320
Sequence

48 - 

aaaagcuggguugagagggcga

 - 69

Get sequence
Deep sequencing238265 reads, 506 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).