Stem-loop sequence rno-mir-300

AccessionMI0000971 (change log)
DescriptionRattus norvegicus miR-300 stem-loop
Gene family MIPF0000018; mir-154
Literature search

7 open access papers mention rno-mir-300
(36 sentences)

Stem-loop
      a           g  au             gc   a 
5' gcu cuugaagagag uu  ccuuuguguguuu  uuu c
   ||| ||||||||||| ||  |||||||||||||  |||  
3' cga gagcuucucuc aa  gggaacguauaag  aag g
      g           g  -c             ua   c 
Get sequence
Deep sequencing
371732 reads, 217 reads per million, 463 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133874152-133874230 [+]
sense
ENSRNOT00000053757 ; Mir300-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-300
rno-mir-494chr6: 133864370-133864452 [+]
rno-mir-679chr6: 133864564-133864700 [+]
rno-mir-1193chr6: 133864698-133864817 [+]
rno-mir-666chr6: 133866523-133866621 [+]
rno-mir-543chr6: 133866660-133866739 [+]
rno-mir-495chr6: 133868288-133868367 [+]
rno-mir-667chr6: 133869570-133869661 [+]
rno-mir-376cchr6: 133872439-133872522 [+]
rno-mir-376bchr6: 133873095-133873180 [+]
rno-mir-3595chr6: 133873587-133873706 [-]
rno-mir-376achr6: 133873605-133873686 [+]
rno-mir-300chr6: 133874152-133874230 [+]
rno-mir-381chr6: 133876615-133876675 [+]
rno-mir-487bchr6: 133877124-133877205 [+]
rno-mir-3576chr6: 133877812-133877926 [-]
rno-mir-539chr6: 133877832-133877907 [+]
rno-mir-6331chr6: 133878578-133878700 [+]
rno-mir-544chr6: 133879169-133879246 [+]
Database links

Mature sequence rno-miR-300-5p

Accession MIMAT0004743
Sequence

6 - 

uugaagagagguuauccuuugu

 - 27

Get sequence
Deep sequencing889 reads, 124 experiments
Evidence experimental; cloned [2-3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-300-3p

Accession MIMAT0000902
Previous IDsrno-miR-300
Sequence

51 - 

uaugcaagggcaagcucucuuc

 - 72

Get sequence
Deep sequencing370842 reads, 463 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).