Stem-loop sequence rno-mir-299a

AccessionMI0000970 (change log)
Previous IDsrno-mir-299
DescriptionRattus norvegicus miR-299 stem-loop
Gene family MIPF0000186; mir-299
Literature search

3 open access papers mention rno-mir-299a
(4 sentences)

Stem-loop
        a                      uu 
5' aagaa ugguuuaccgucccacauacau  u
   ||||| ||||||||||||||||||||||  g
3' uucuu gccaaauggcaggguguaugua  a
        c                      ug 
Get sequence
Deep sequencing
14023 reads, 2.85 reads per million, 351 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133859324-133859386 [+]
antisense
ENSRNOT00000053630 ; Mir3563-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-299a
rno-mir-379chr6: 133857700-133857784 [+]
rno-mir-411chr6: 133858849-133858924 [+]
rno-mir-299bchr6: 133859295-133859412 [-]
rno-mir-299achr6: 133859324-133859386 [+]
rno-mir-3579chr6: 133860473-133860585 [-]
rno-mir-380chr6: 133860490-133860566 [+]
rno-mir-323chr6: 133861199-133861284 [+]
rno-mir-758chr6: 133861498-133861575 [+]
rno-mir-329chr6: 133862168-133862264 [+]
rno-mir-494chr6: 133864370-133864452 [+]
rno-mir-679chr6: 133864564-133864700 [+]
rno-mir-1193chr6: 133864698-133864817 [+]
rno-mir-666chr6: 133866523-133866621 [+]
rno-mir-543chr6: 133866660-133866739 [+]
rno-mir-495chr6: 133868288-133868367 [+]
Database links

Mature sequence rno-miR-299a-5p

Accession MIMAT0000901
Previous IDsrno-miR-299
Sequence

7 - 

ugguuuaccgucccacauacau

 - 28

Get sequence
Deep sequencing5773 reads, 276 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-299a-3p

Accession MIMAT0017167
Previous IDsrno-miR-299*
Sequence

39 - 

uaugugggacgguaaaccgcu

 - 59

Get sequence
Deep sequencing8250 reads, 317 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).