Stem-loop sequence rno-mir-298

AccessionMI0000969 (change log)
DescriptionRattus norvegicus miR-298 stem-loop
Gene family MIPF0000206; mir-298
Stem-loop
      gg   uc       -       -         uug    u 
5' cca  ccu  ggcagag gagggcu guucuuccc   gguu u
   |||  |||  ||||||| ||||||| |||||||||   ||||  
3' ggu  gga  ucgucuc cuuccga caaggaggg   ucag a
      ga   -u       u       u         ---    u 
Get sequence
Deep sequencing
5698 reads, 47.2 reads per million, 36 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 172357943-172358024 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-298
rno-mir-298chr3: 172357943-172358024 [-]
rno-mir-296chr3: 172357490-172357567 [-]
Database links

Mature sequence rno-miR-298-5p

Accession MIMAT0000900
Previous IDsrno-miR-298
Sequence

11 - 

ggcagaggagggcuguucuuccc

 - 33

Get sequence
Deep sequencing5580 reads, 36 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-298-3p

Accession MIMAT0017166
Previous IDsrno-miR-298*
Sequence

52 - 

aggaacuagccuucucucugcu

 - 73

Get sequence
Deep sequencing118 reads, 13 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).