Stem-loop sequence rno-mir-296

Accession MI0000967
Description Rattus norvegicus miR-296 stem-loop
Gene family MIPF0000159; mir-296
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-296. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-296 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-296 has been named an "angiomiR" due to being characterised as a microRNA which regulates angiogenesis, the process of growth and creation of new blood vessels. miR-296 is thought to have a specific role in cancer in promoting tumour angiogenesis. It achieves this by targeting HGS mRNA, reducing its expression in endothelial cells which then results in greater number of VEGF receptors. miR-296 has predicted target sites in the transcription factor NANOG and may also contribute to carcinogenesis by dysregulating p53.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
g   -     u        c  c         g   -u c 
 gac cuuuc ggagggcc cc cucaauccu uug  g u
 ||| ||||| |||||||| || ||||||||| |||  |  
 cug ggaag ccucucgg gg ggguuggga gac  c c
-   u     u        a  u         -   uu g 
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
3: 165193820-165193897 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-296
rno-mir-298 3: 165194273-165194354 [-]
rno-mir-296 3: 165193820-165193897 [-]
Database links

Mature sequence rno-miR-296-5p

Accession MIMAT0000898
Previous IDs rno-miR-296;rno-miR-296*
Sequence

13 - 

agggcccccccucaauccugu

 - 33

Get sequence
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-296-3p

Accession MIMAT0004742
Previous IDs rno-miR-296
Sequence

47 - 

gaggguuggguggaggcucucc

 - 68

Get sequence
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).