Stem-loop sequence rno-mir-296

AccessionMI0000967 (change log)
DescriptionRattus norvegicus miR-296 stem-loop
Gene family MIPF0000159; mir-296
Literature search

16 open access papers mention rno-mir-296
(45 sentences)

Stem-loop
   g   -     u        c  c         g   -u c 
5'  gac cuuuc ggagggcc cc cucaauccu uug  g u
    ||| ||||| |||||||| || ||||||||| |||  |  
3'  cug ggaag ccucucgg gg ggguuggga gac  c c
   -   u     u        a  u         -   uu g 
Get sequence
Deep sequencing
3895 reads, 50 reads per million, 280 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 172357490-172357567 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-296
rno-mir-298chr3: 172357943-172358024 [-]
rno-mir-296chr3: 172357490-172357567 [-]
Database links

Mature sequence rno-miR-296-5p

Accession MIMAT0000898
Previous IDsrno-miR-296;rno-miR-296*
Sequence

13 - 

agggcccccccucaauccugu

 - 33

Get sequence
Deep sequencing3449 reads, 259 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-296-3p

Accession MIMAT0004742
Previous IDsrno-miR-296
Sequence

47 - 

gaggguuggguggaggcucucc

 - 68

Get sequence
Deep sequencing446 reads, 138 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).