Stem-loop sequence rno-mir-292

AccessionMI0000966 (change log)
DescriptionRattus norvegicus miR-292 stem-loop
Gene family MIPF0000068; mir-290
Literature search

3 open access papers mention rno-mir-292
(3 sentences)

Stem-loop
      c u           --a    g   u    uggg     u 
5' caa c gugauacucaa   cugg ggc cuuu    uuuuc u
   ||| | |||||||||||   |||| ||| ||||    |||||  
3' guu g cauugugaguu   gacc ccg gaaa    agaag u
      a c           uug    g   u    ----     g 
Get sequence
Deep sequencing
332 reads, 0 reads per million, 61 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 64538119-64538200 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-292
rno-mir-290chr1: 64538705-64538785 [-]
rno-mir-291achr1: 64538407-64538488 [-]
rno-mir-292chr1: 64538119-64538200 [-]
rno-mir-291bchr1: 64537831-64537938 [-]
rno-mir-293chr1: 64537107-64537178 [-]
rno-mir-294chr1: 64536746-64536816 [-]
rno-mir-295-1chr1: 64536623-64536703 [-]
Database links

Mature sequence rno-miR-292-5p

Accession MIMAT0000896
Sequence

12 - 

acucaaacugggggcucuuuug

 - 33

Get sequence
Deep sequencing166 reads, 45 experiments
Evidence by similarity; MI0000390
Predicted targets

Mature sequence rno-miR-292-3p

Accession MIMAT0000897
Sequence

51 - 

aagugccgccagguuuugagugu

 - 73

Get sequence
Deep sequencing164 reads, 36 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).