Stem-loop sequence rno-mir-223

AccessionMI0000963 (change log)
DescriptionRattus norvegicus miR-223 stem-loop
Gene family MIPF0000067; mir-223
Literature search

49 open access papers mention rno-mir-223
(371 sentences)

Stem-loop
   u    ccuucu   -gu        cc u              gaguug         u 
5'  cugg      gca   guuacgcu  g guauuugacaagcu      gacacucug g
    ||||      |||   ||||||||  | ||||||||||||||      ||||||||| u
3'  gacu      cgu   cgguguga  c cauaaacuguuuga      cugugagau g
   -    ---auu   acu        ac c              ------         g 
Get sequence
Deep sequencing
72988 reads, 68.4 reads per million, 490 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 65367812-65367921 [+]
intergenic
Database links

Mature sequence rno-miR-223-5p

Accession MIMAT0017165
Previous IDsrno-miR-223*
Sequence

26 - 

cguguauuugacaagcugaguug

 - 48

Get sequence
Deep sequencing2585 reads, 322 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-223-3p

Accession MIMAT0000892
Previous IDsrno-miR-223
Sequence

68 - 

ugucaguuugucaaauacccc

 - 88

Get sequence
Deep sequencing70387 reads, 490 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).