Stem-loop sequence rno-mir-223

Accession MI0000963
Description Rattus norvegicus miR-223 stem-loop
Gene family MIPF0000067; mir-223
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-223. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology MicroRNA-223 (miR-223) is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. miR-223 is a hematopoietic specific microRNA with crucial functions in myeloid lineage development. It plays an essential role in promoting granulocytic differentiation while also being associated with the suppression of erythrocytic differentiation. miR-223 is commonly repressed in hepatocellular carcinoma and leukemia. Higher expression levels of miRNA-223 are associated with extranodal marginal-zone lymphoma of mucosa-associated lymphoid tissue of the stomach and recurrent ovarian cancer. In some cancers the microRNA-223 down-regulation is correlated with higher tumor burden, disease aggressiveness, and poor prognostic factors. MicroRNA-223 is also associated with rheumatoid arthritis, sepsis, type 2 diabetes, and hepatic ischemia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u    ccuucu   -gu        cc u              gaguug         u 
 cugg      gca   guuacgcu  g guauuugacaagcu      gacacucug g
 ||||      |||   ||||||||  | ||||||||||||||      ||||||||| u
 gacu      cgu   cgguguga  c cauaaacuguuuga      cugugagau g
-    ---auu   acu        ac c              ------         g 
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
X: 83869053-83869162 [+]
intergenic
Database links

Mature sequence rno-miR-223-5p

Accession MIMAT0017165
Previous IDs rno-miR-223*
Sequence

26 - 

cguguauuugacaagcugaguug

 - 48

Get sequence
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-223-3p

Accession MIMAT0000892
Previous IDs rno-miR-223
Sequence

68 - 

ugucaguuugucaaauacccc

 - 88

Get sequence
Evidence experimental; cloned [1], SOLiD [2]
Validated targets
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).