Stem-loop sequence rno-mir-222

AccessionMI0000962 (change log)
DescriptionRattus norvegicus miR-222 stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
   --aa    uag      c    u              -     auc   ucuu 
5'     ggau   ggugcc ucag ggcucaguagccag uguag   cug    u
       ||||   |||||| |||| |||||||||||||| |||||   |||    g
3'     ucua   cuacgg aguc cugggucaucgguc acauc   gac    g
   ucga    ---      u    u              u     gac   uaau 
Get sequence
Deep sequencing
8101 reads, 64.1 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 3683919-3684021 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-222
rno-mir-222chrX: 3683919-3684021 [+]
rno-mir-221chrX: 3684480-3684588 [+]
Database links

Mature sequence rno-miR-222-5p

Accession MIMAT0017164
Previous IDsrno-miR-222*
Sequence

22 - 

ggcucaguagccaguguagau

 - 42

Get sequence
Deep sequencing28 reads, 15 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-222-3p

Accession MIMAT0000891
Previous IDsrno-miR-222
Sequence

62 - 

agcuacaucuggcuacugggu

 - 82

Get sequence
Deep sequencing8073 reads, 39 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).