Stem-loop sequence rno-mir-221

AccessionMI0000961 (change log)
DescriptionRattus norvegicus miR-221 stem-loop
Gene family MIPF0000051; mir-221
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-221_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-221 microRNA (and its paralogue, mir-222) is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-221 is an oncogenic microRNA. It targets CD117, which then prevents cell migration and proliferation in endothelial cells. miR-221 is known as an anti angiogenic miRNA. Recent important studies have reported that miR-221 is also involved in induction of angiogenesis. RNA induced Silencing Complex (RISC) proteins SND1 and AEG-1 induces miR-221 expression in Liver cancer. In liver cancer miR-221 induces the tumor angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ----ugaaua       cugg   a    -  ug   u         auuu    -   u 
5'           uccaggu    ggc ugaa cc  gca acaauguag    cugu guu g
             |||||||    ||| |||| ||  ||| |||||||||    |||| ||| u
3'           aggucca    ucg acuu gg  cgu uguuacauc    gaca cgg u
   cucuuuacga       ----   g    u  gu   c         ----    a   a 
Get sequence
Deep sequencing
9574 reads, 59 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 3684480-3684588 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-221
rno-mir-222chrX: 3683919-3684021 [+]
rno-mir-221chrX: 3684480-3684588 [+]
Database links

Mature sequence rno-miR-221-5p

Accession MIMAT0017163
Previous IDsrno-miR-221*
Sequence

25 - 

accuggcauacaauguagauuuc

 - 47

Get sequence
Deep sequencing623 reads, 36 experiments
Evidence experimental; SOLiD [4]
Predicted targets

Mature sequence rno-miR-221-3p

Accession MIMAT0000890
Previous IDsrno-miR-221
Sequence

65 - 

agcuacauugucugcuggguuuc

 - 87

Get sequence
Deep sequencing8950 reads, 39 experiments
Evidence experimental; cloned [1-3], Northern [1], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).