Stem-loop sequence rno-mir-221

AccessionMI0000961 (change log)
DescriptionRattus norvegicus miR-221 stem-loop
Gene family MIPF0000051; mir-221
Literature search

62 open access papers mention rno-mir-221
(301 sentences)

Stem-loop
   ----ugaaua       cugg   a    -  ug   u         auuu    -   u 
5'           uccaggu    ggc ugaa cc  gca acaauguag    cugu guu g
             |||||||    ||| |||| ||  ||| |||||||||    |||| ||| u
3'           aggucca    ucg acuu gg  cgu uguuacauc    gaca cgg u
   cucuuuacga       ----   g    u  gu   c         ----    a   a 
Get sequence
Deep sequencing
401857 reads, 221 reads per million, 494 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 3684480-3684588 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-221
rno-mir-222chrX: 3683919-3684021 [+]
rno-mir-221chrX: 3684480-3684588 [+]
Database links

Mature sequence rno-miR-221-5p

Accession MIMAT0017163
Previous IDsrno-miR-221*
Sequence

25 - 

accuggcauacaauguagauuuc

 - 47

Get sequence
Deep sequencing25918 reads, 429 experiments
Evidence experimental; SOLiD [4]
Predicted targets

Mature sequence rno-miR-221-3p

Accession MIMAT0000890
Previous IDsrno-miR-221
Sequence

65 - 

agcuacauugucugcuggguuuc

 - 87

Get sequence
Deep sequencing375930 reads, 494 experiments
Evidence experimental; cloned [1-3], Northern [1], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).