Stem-loop sequence rno-mir-219a-2

AccessionMI0000960 (change log)
DescriptionRattus norvegicus miR-219a-2 stem-loop
Gene family MIPF0000044; mir-219
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-219_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, the microRNA miR-219 was predicted in vertebrates by conservation between human, mouse and pufferfish and cloned in pufferfish. It was later predicted and confirmed experimentally in Drosophila. Homologs of miR-219 have since been predicted or experimentally confirmed in a wide range of species, including the platyhelminth Schmidtea mediterranea, several arthropod species and a wide range of vertebrates (MIPF0000044). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 5' arm of the hairpin. miR-219 has also been linked with NMDA receptor signalling in humans, and it has been suggested that deregulation of this miRNA can lead to the expression of mental disorders such as schizophrenia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   acuca       c     u   u     aa           uac a  c 
5'      ggggcuu accac gau gucca  cgcaauucuug   g gu u
        ||||||| ||||| ||| |||||  |||||||||||   | || g
3'      ccucgag uggug cua caggu  guguuaagagc   c cg c
   ---gg       u     u   -     cg           caa -  g 
Get sequence
Deep sequencing
29174 reads, 127 reads per million, 33 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 8407430-8407525 [-]
antisense
ENSRNOT00000053575 ; Mir2964-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-219a-2
rno-mir-219a-2chr3: 8407430-8407525 [-]
rno-mir-219bchr3: 8407427-8407526 [+]
Database links

Mature sequence rno-miR-219a-5p

Accession MIMAT0000889
Previous IDsrno-miR-219
Sequence

19 - 

ugauuguccaaacgcaauucu

 - 39

Get sequence
Deep sequencing6687 reads, 27 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-219a-2-3p

Accession MIMAT0005446
Sequence

62 - 

agaauuguggcuggacaucugu

 - 83

Get sequence
Deep sequencing25342 reads, 20 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).