Stem-loop sequence rno-mir-219a-2

AccessionMI0000960 (change log)
DescriptionRattus norvegicus miR-219a-2 stem-loop
Gene family MIPF0000044; mir-219
Literature search

29 open access papers mention rno-mir-219a-2
(228 sentences)

Stem-loop
   acuca       c     u   u     aa           uac a  c 
5'      ggggcuu accac gau gucca  cgcaauucuug   g gu u
        ||||||| ||||| ||| |||||  |||||||||||   | || g
3'      ccucgag uggug cua caggu  guguuaagagc   c cg c
   ---gg       u     u   -     cg           caa -  g 
Get sequence
Deep sequencing
250249 reads, 151 reads per million, 404 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 8407430-8407525 [-]
antisense
ENSRNOT00000053575 ; Mir2964-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-219a-2
rno-mir-219a-2chr3: 8407430-8407525 [-]
rno-mir-219bchr3: 8407427-8407526 [+]
Database links

Mature sequence rno-miR-219a-5p

Accession MIMAT0000889
Previous IDsrno-miR-219
Sequence

19 - 

ugauuguccaaacgcaauucu

 - 39

Get sequence
Deep sequencing64975 reads, 372 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-219a-2-3p

Accession MIMAT0005446
Sequence

62 - 

agaauuguggcuggacaucugu

 - 83

Get sequence
Deep sequencing213455 reads, 266 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).