Stem-loop sequence rno-mir-219a-1

AccessionMI0000959 (change log)
DescriptionRattus norvegicus miR-219a-1 stem-loop
Gene family MIPF0000044; mir-219
Literature search

28 open access papers mention rno-mir-219a-1
(221 sentences)

Stem-loop
   ---------cuguccc    c       cu   u     a            a   ucu 
5'                 gggc gcggcuc  gau gucca acgcaauucucg guc   g
                   |||| |||||||  ||| ||||| |||||||||||| |||   g
3'                 cccg cgccgag  cug caggu ugcguugagagc cgg   c
   gggggagcuccaaacc    c       cc   -     c            -   ccu 
Get sequence
Deep sequencing
36427 reads, 10.8 reads per million, 453 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr20: 3816158-3816267 [-]
intergenic
Database links

Mature sequence rno-miR-219a-5p

Accession MIMAT0000889
Previous IDsrno-miR-219
Sequence

21 - 

ugauuguccaaacgcaauucu

 - 41

Get sequence
Deep sequencing64975 reads, 372 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-219a-1-3p

Accession MIMAT0004741
Sequence

62 - 

agaguugcgucuggacgucccg

 - 83

Get sequence
Deep sequencing3953 reads, 407 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).