Stem-loop sequence rno-mir-218a-1

AccessionMI0000958 (change log)
Previous IDsrno-mir-218-1
DescriptionRattus norvegicus miR-218a-1 stem-loop
Gene family MIPF0000026; mir-218
Literature search

14 open access papers mention rno-mir-218a-1
(43 sentences)

Stem-loop
   -   au  c  a   a   u      u         cu        gc    gag 
5'  gug  aa gu gcg gau uucugu gugcuugau  aaccaugu  uugc   g
    |||  || || ||| ||| |||||| |||||||||  ||||||||  ||||   u
3'  cau  uu cg cgc cug aaggua cacgaacug  uugguaca  aaug   a
   a   cu  -  a   a   c      c         cc        -a    agu 
Get sequence
Deep sequencing
364212 reads, 218 reads per million, 482 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr14: 66923083-66923192 [-]
sense
ENSRNOT00000005477 ; Slit2-201; intron 15
antisense
ENSRNOT00000053609 ; Mir3565-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-218a-1
rno-mir-218bchr14: 66923083-66923196 [+]
rno-mir-218a-1chr14: 66923083-66923192 [-]
Database links

Mature sequence rno-miR-218a-5p

Accession MIMAT0000888
Previous IDsrno-miR-218;rno-miR-218a
Sequence

25 - 

uugugcuugaucuaaccaugu

 - 45

Get sequence
Deep sequencing722210 reads, 480 experiments
Evidence experimental; cloned [1-3], Northern [1-2], SOLiD [4]
Predicted targets

Mature sequence rno-miR-218a-1-3p

Accession MIMAT0017162
Previous IDsrno-miR-218-1*;rno-miR-218a-1*
Sequence

64 - 

aaacaugguuccgucaagcac

 - 84

Get sequence
Deep sequencing3212 reads, 266 experiments
Evidence experimental; SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).