Stem-loop sequence rno-mir-218a-2

AccessionMI0000957 (change log)
Previous IDsrno-mir-218-2
DescriptionRattus norvegicus miR-218a-2 stem-loop
Gene family MIPF0000026; mir-218
Literature search

14 open access papers mention rno-mir-218a-2
(43 sentences)

Stem-loop
   gac   uu -cc   gg       uuu         cu        gguggaacga  g 
5'    cag  g   gcg  gcuuucc   gugcuugau  aaccaugu          ug a
      |||  |   |||  |||||||   |||||||||  ||||||||          ||  
3'    guc  c   cgc  cgaaagg   cacgaacug  uugguaca          gc a
   -ac   cu ucu   ua       cgc         uc        --------ag  a 
Get sequence
Deep sequencing
364589 reads, 218 reads per million, 482 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 20428661-20428770 [+]
sense
ENSRNOT00000009714 ; Slit3-201; intron 10
Database links

Mature sequence rno-miR-218a-5p

Accession MIMAT0000888
Previous IDsrno-miR-218;rno-miR-218a
Sequence

25 - 

uugugcuugaucuaaccaugu

 - 45

Get sequence
Deep sequencing722210 reads, 480 experiments
Evidence experimental; cloned [1-3], Northern [1-2], SOLiD [4]
Predicted targets

Mature sequence rno-miR-218a-2-3p

Accession MIMAT0004740
Previous IDsrno-miR-218*;rno-miR-218-2*;rno-miR-218a-2*
Sequence

67 - 

caugguucugucaagcaccgcg

 - 88

Get sequence
Deep sequencing3255 reads, 212 experiments
Evidence experimental; cloned [3], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).