miRBase has moved to http://www.mirbase.org/ - please update your links.

Stem-loop sequence MI0000957

Accession MI0000957
ID rno-mir-218-2
Description Rattus norvegicus miR-218-2 stem-loop
Stem-loop 
gac   uu -cc   gg       uuu         cu        gguggaacga  g 
   cag  g   gcg  gcuuucc   gugcuugau  aaccaugu          ug a
   |||  |   |||  |||||||   |||||||||  ||||||||          ||  
   guc  c   cgc  cgaaagg   cacgaacug  uugguaca          gc a
-ac   cu ucu   ua       cgc         uc        --------ag  a
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
10: 20487432-20487541 [+]
sense
ENSRNOT00000009714 ; Slit3; intron 14

View flanking features
Gene family

MIPF0000026; mir-218

Mature sequence MIMAT0000888

Accession MIMAT0000888
ID rno-miR-218
Sequence

25 -  

uugugcuugaucuaaccaugu

 - 45

Get sequence
Evidence experimental; cloned [1-3], Northern [1-2]
Predicted targets

Minor miR* sequence MIMAT0004740

Accession MIMAT0004740
ID rno-miR-218*
Sequence

67 -  

caugguucugucaagcaccgcg

 - 88

Get sequence
Evidence experimental; cloned [3]
Predicted targets

References

1
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
"Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3
"A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).