Stem-loop sequence rno-mir-218a-2

Accession MI0000957
Previous IDs rno-mir-218-2
Description Rattus norvegicus miR-218a-2 stem-loop
Gene family MIPF0000026; mir-218
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-218_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-218 microRNA precursor is a small non-coding RNA that regulates gene expression by antisense binding. miR-218 appears to be a vertebrate specific microRNA and has now been predicted and experimentally confirmed in a wide range of vertebrate species. The extents of the hairpin precursors are not known. In this case the mature sequence in excised from the 5'arm of the hairpin. miR-218, along with miR-585, has been found to be silenced by DNA methylation in oral squamous cell carcinoma. It is also downregulated in Nasopharyngeal carcinoma, with artificially-induced expression serving to slow tumour growth. miR-218 has also been found to have tumour suppressing qualities in bladder cancer cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
gac   uu -cc   gg       uuu         cu        gguggaacga  g 
   cag  g   gcg  gcuuucc   gugcuugau  aaccaugu          ug a
   |||  |   |||  |||||||   |||||||||  ||||||||          ||  
   guc  c   cgc  cgaaagg   cacgaacug  uugguaca          gc a
-ac   cu ucu   ua       cgc         uc        --------ag  a 
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
10: 20487432-20487541 [+]
sense
ENSRNOT00000009714 ; Slit3; intron 10
ENSRNOT00000009714 ; Slit3; intron 10
ENSRNOT00000009714 ; Slit3; intron 10
Database links

Mature sequence rno-miR-218a-5p

Accession MIMAT0000888
Previous IDs rno-miR-218;rno-miR-218a
Sequence

25 - 

uugugcuugaucuaaccaugu

 - 45

Get sequence
Evidence experimental; cloned [1-3], Northern [1-2], SOLiD [4]

Mature sequence rno-miR-218a-2-3p

Accession MIMAT0004740
Previous IDs rno-miR-218*;rno-miR-218-2*;rno-miR-218a-2*
Sequence

67 - 

caugguucugucaagcaccgcg

 - 88

Get sequence
Evidence experimental; cloned [3], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).