Stem-loop sequence rno-mir-218a-2

AccessionMI0000957 (change log)
Previous IDsrno-mir-218-2
DescriptionRattus norvegicus miR-218a-2 stem-loop
Gene family MIPF0000026; mir-218
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-218_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-218 microRNA precursor is a small non-coding RNA that regulates gene expression by antisense binding. miR-218 appears to be a vertebrate specific microRNA and has now been predicted and experimentally confirmed in a wide range of vertebrate species. The extents of the hairpin precursors are not known. In this case the mature sequence in excised from the 5'arm of the hairpin. miR-218, along with miR-585, has been found to be silenced by DNA methylation in oral squamous cell carcinoma. It is also downregulated in Nasopharyngeal carcinoma, with artificially-induced expression serving to slow tumour growth. miR-218 has also been found to have tumour suppressing qualities in bladder cancer cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   gac   uu -cc   gg       uuu         cu        gguggaacga  g 
5'    cag  g   gcg  gcuuucc   gugcuugau  aaccaugu          ug a
      |||  |   |||  |||||||   |||||||||  ||||||||          ||  
3'    guc  c   cgc  cgaaagg   cacgaacug  uugguaca          gc a
   -ac   cu ucu   ua       cgc         uc        --------ag  a 
Get sequence
Deep sequencing
12583 reads, 92.1 reads per million, 38 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 20428661-20428770 [+]
sense
ENSRNOT00000009714 ; Slit3-201; intron 10
Database links

Mature sequence rno-miR-218a-5p

Accession MIMAT0000888
Previous IDsrno-miR-218;rno-miR-218a
Sequence

25 - 

uugugcuugaucuaaccaugu

 - 45

Get sequence
Deep sequencing24960 reads, 38 experiments
Evidence experimental; cloned [1-3], Northern [1-2], SOLiD [4]
Predicted targets

Mature sequence rno-miR-218a-2-3p

Accession MIMAT0004740
Previous IDsrno-miR-218*;rno-miR-218-2*;rno-miR-218a-2*
Sequence

67 - 

caugguucugucaagcaccgcg

 - 88

Get sequence
Deep sequencing94 reads, 15 experiments
Evidence experimental; cloned [3], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).