Stem-loop sequence rno-mir-216a

AccessionMI0000955 (change log)
Previous IDsrno-mir-216
DescriptionRattus norvegicus miR-216a stem-loop
Gene family MIPF0000054; mir-216
Literature search

13 open access papers mention rno-mir-216a
(40 sentences)

Stem-loop
   -----------guua   a  ag     u         cu   a        --   uc 
5'                gcu ug  uuagu uaaucucag  ggc acugugag  aug  c
                  ||| ||  ||||| |||||||||  ||| ||||||||  |||  c
3'                cga ac  aaucg auuaggguc  cug ugacacuc  uac  u
   cuccaguuccuuuaa   g  -a     u         -u   g        cu   ua 
Get sequence
Deep sequencing
240732 reads, 561 reads per million, 246 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr14: 113112129-113112234 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-216a
rno-mir-216achr14: 113112129-113112234 [+]
rno-mir-217chr14: 113119529-113119633 [+]
Database links

Mature sequence rno-miR-216a-5p

Accession MIMAT0000886
Previous IDsrno-miR-216;rno-miR-216a
Sequence

19 - 

uaaucucagcuggcaacuguga

 - 40

Get sequence
Deep sequencing218039 reads, 234 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-216a-3p

Accession MIMAT0017160
Previous IDsrno-miR-216a*
Sequence

59 - 

cacaguggucucugggauuaug

 - 80

Get sequence
Deep sequencing22685 reads, 129 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).