Stem-loop sequence rno-mir-214

AccessionMI0000954 (change log)
DescriptionRattus norvegicus miR-214 stem-loop
Gene family MIPF0000062; mir-214
Literature search

59 open access papers mention rno-mir-214
(519 sentences)

Stem-loop
   guccuggauggaca a           u          aca            aacau 
5'               g guugucaugug cugccugucu   cuugcugugcag     c
                 | ||||||||||| ||||||||||   ||||||||||||     c
3'               c caacaguacac gacggacaga   ggacgacauguc     g
   ---------uccga c           u          cac            cacuc 
Get sequence
Deep sequencing
76455 reads, 9.13 reads per million, 471 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr13: 80130905-80131014 [+]
antisense
ENSRNOT00000053636 ; Mir3120-201; exon 1
ENSRNOT00000064219 ; Dnm3-204; intron 14
ENSRNOT00000068490 ; Dnm3-201; intron 15
ENSRNOT00000047799 ; Dnm3-202; intron 15
ENSRNOT00000067653 ; Dnm3-203; intron 15
ENSRNOT00000041058 ; Dnm3-205; intron 15
Clustered miRNAs
< 10kb from rno-mir-214
rno-mir-199achr13: 80125487-80125596 [+]
rno-mir-214chr13: 80130905-80131014 [+]
rno-mir-3120chr13: 80130909-80131025 [-]
Database links

Mature sequence rno-miR-214-5p

Accession MIMAT0017159
Previous IDsrno-miR-214*
Sequence

14 - 

agaguugucaugugucu

 - 30

Get sequence
Deep sequencing211 reads, 106 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-214-3p

Accession MIMAT0000885
Previous IDsrno-miR-214
Sequence

71 - 

acagcaggcacagacaggcag

 - 91

Get sequence
Deep sequencing61382 reads, 469 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).