Stem-loop sequence rno-mir-181a-1

AccessionMI0000953 (change log)
Previous IDsrno-mir-213
DescriptionRattus norvegicus miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

63 open access papers mention rno-mir-181a-1
(294 sentences)

Stem-loop
   -----------a    -   uc  u a   u      cu       a    ggaau 
5'             gguu gcu  ag g aca ucaacg  gucggug guuu     u
               |||| |||  || | ||| ||||||  ||||||| ||||     c
3'             ccaa cga  uc c ugu aguugc  cagcuac caaa     a
   ccucaucuauua    u   ua  c a   u      --       -    aauaa 
Get sequence
Deep sequencing
40510662 reads, 2.86e+04 reads per million, 510 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr13: 54952742-54952841 [+]
antisense
ENSRNOT00000053617 ; Mir3570-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-181a-1
rno-mir-3570chr13: 54952723-54952839 [-]
rno-mir-181a-1chr13: 54952742-54952841 [+]
rno-mir-181b-1chr13: 54952903-54953012 [+]
Database links

Mature sequence rno-miR-181a-5p

Accession MIMAT0000858
Previous IDsrno-miR-181a
Sequence

15 - 

aacauucaacgcugucggugagu

 - 37

Get sequence
Deep sequencing80452393 reads, 510 experiments
Evidence experimental; cloned [3-4], SOLiD [4]
Predicted targets

Mature sequence rno-miR-181a-1-3p

Accession MIMAT0000884
Previous IDsrno-miR-213;rno-miR-181a*;rno-miR-181a-1*
Sequence

55 - 

accaucgaccguugauuguacc

 - 76

Get sequence
Deep sequencing283222 reads, 494 experiments
Evidence experimental; cloned [1], SOLiD [4]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).