Stem-loop sequence rno-mir-212

AccessionMI0000952 (change log)
DescriptionRattus norvegicus miR-212 stem-loop
Gene family MIPF0000065; mir-132
Literature search

35 open access papers mention rno-mir-212
(299 sentences)

Stem-loop
   cgggauauccccgccc    -  c   c   -ca  u     cu      c      ccc     
5'                 gggc ag gcg cgg   cc uggcu  agacug uuacug   gggc 
                   |||| || ||| |||   || |||||  |||||| ||||||   ||| c
3'                 cccg uc cgc gcc   gg acuga  ucugac aaugac   cccg 
   ------------ccgc    g  -   a   acc  c     cc      -      --u     
Get sequence
Deep sequencing
121528 reads, 69.7 reads per million, 433 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 62014702-62014812 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-212
rno-mir-212chr10: 62014702-62014812 [+]
rno-mir-132chr10: 62014995-62015095 [+]
Database links

Mature sequence rno-miR-212-5p

Accession MIMAT0017158
Previous IDsrno-miR-212*
Sequence

32 - 

accuuggcucuagacugcuuacug

 - 55

Get sequence
Deep sequencing39297 reads, 331 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-212-3p

Accession MIMAT0000883
Previous IDsrno-miR-212
Sequence

72 - 

uaacagucuccagucacggcca

 - 93

Get sequence
Deep sequencing82229 reads, 421 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).