Stem-loop sequence rno-mir-212

AccessionMI0000952 (change log)
DescriptionRattus norvegicus miR-212 stem-loop
Gene family MIPF0000065; mir-132
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-132. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-132 microRNA is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, generally reducing protein levels through the cleavage of mRNAs or the repression of their translation. Several targets for miR-132 have been described, including mediators of neurological development, synaptic transmission, inflammation and angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cgggauauccccgccc    -  c   c   -ca  u     cu      c      ccc     
5'                 gggc ag gcg cgg   cc uggcu  agacug uuacug   gggc 
                   |||| || ||| |||   || |||||  |||||| ||||||   ||| c
3'                 cccg uc cgc gcc   gg acuga  ucugac aaugac   cccg 
   ------------ccgc    g  -   a   acc  c     cc      -      --u     
Get sequence
Deep sequencing
3381 reads, 25 reads per million, 36 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 62014702-62014812 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-212
rno-mir-212chr10: 62014702-62014812 [+]
rno-mir-132chr10: 62014995-62015095 [+]
Database links

Mature sequence rno-miR-212-5p

Accession MIMAT0017158
Previous IDsrno-miR-212*
Sequence

32 - 

accuuggcucuagacugcuuacug

 - 55

Get sequence
Deep sequencing1065 reads, 26 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-212-3p

Accession MIMAT0000883
Previous IDsrno-miR-212
Sequence

72 - 

uaacagucuccagucacggcca

 - 93

Get sequence
Deep sequencing2316 reads, 36 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).