Stem-loop sequence rno-mir-210

AccessionMI0000950 (change log)
DescriptionRattus norvegicus miR-210 stem-loop
Gene family MIPF0000086; mir-210
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-210_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-210 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-210 has been strongly linked with the hypoxia pathway, and is upregulated in response to Hypoxia-inducible factors. It is also overexpressed in cells affected by cardiac disease and tumours. MiRNA-210 in particular, has been studied for its effects in rescuing cardiac function after myocardial infarcts via the up-regulation of angiogenesis and inhibition of cardiomyocyte apoptosis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cc  gg -a  cc u     cu    a     a   cc    -     c  c   gc 
5'   gg  c  gu  c ccagg  cagg cagcc cug  caca gcaca ug guu  u
     ||  |  ||  | |||||  |||| ||||| |||  |||| ||||| || |||   
3'   cc  g  cg  g ggucc  gucu gucgg gac  gugu cgugu ac cag  c
   --  aa cg  ac -     cu    a     c   -a    g     c  c   gc 
Get sequence
Deep sequencing
8712 reads, 7.69 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 214208355-214208464 [-]
antisense
ENSRNOT00000053739 ; Mir3574-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-210
rno-mir-210chr1: 214208355-214208464 [-]
rno-mir-3574chr1: 214208349-214208466 [+]
Database links

Mature sequence rno-miR-210-5p

Accession MIMAT0017156
Previous IDsrno-miR-210*
Sequence

28 - 

agccacugcccacagcacacug

 - 49

Get sequence
Deep sequencing294 reads, 33 experiments
Evidence experimental; SOLiD [3]
Predicted targets

Mature sequence rno-miR-210-3p

Accession MIMAT0000881
Previous IDsrno-miR-210
Sequence

66 - 

cugugcgugugacagcggcuga

 - 87

Get sequence
Deep sequencing8413 reads, 39 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).