Stem-loop sequence rno-mir-208a

AccessionMI0000949 (change log)
Previous IDsrno-mir-208
DescriptionRattus norvegicus miR-208 stem-loop
Gene family MIPF0000178; mir-208
Literature search

48 open access papers mention rno-mir-208a
(189 sentences)

Stem-loop
   u         g  ug       g  c  gg      c  a 
5'  uccuuugac gg  agcuuuu gc cg  uuauac ug c
    ||||||||| ||  ||||||| || ||  |||||| || u
3'  aggagacug uu  ucgaaaa cg gc  aauaug ac c
   g         g  gu       a  a  ag      c  u 
Get sequence
Deep sequencing
27049 reads, 55.7 reads per million, 97 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr15: 33613451-33613533 [-]
sense
ENSRNOT00000023302 ; Myh6-201; intron 28
antisense
ENSRNOT00000053706 ; Mir3546-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-208a
rno-mir-208achr15: 33613451-33613533 [-]
rno-mir-3546chr15: 33613435-33613550 [+]
Database links

Mature sequence rno-miR-208a-5p

Accession MIMAT0017155
Previous IDsrno-miR-208*
Sequence

15 - 

gagcuuuuggcccggguuauac

 - 36

Get sequence
Deep sequencing3378 reads, 31 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-208a-3p

Accession MIMAT0000880
Previous IDsrno-miR-208
Sequence

50 - 

auaagacgagcaaaaagc

 - 67

Get sequence
Deep sequencing23664 reads, 101 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).