Stem-loop sequence rno-mir-205

AccessionMI0000947 (change log)
DescriptionRattus norvegicus miR-205 stem-loop
Gene family MIPF0000058; mir-205
Literature search

17 open access papers mention rno-mir-205
(58 sentences)

Stem-loop
   aaa    cccagacaa      ggu       uc           c        ucuua 
5'    cagc         uccaug   ccuccug  cuucauuccac ggagucug     u
      ||||         ||||||   |||||||  ||||||||||| ||||||||      
3'    gucg         agguac   ggaggac  gaagugaggug cuuuagac     g
   acc    ---------      ---       uc           a        caacc 
Get sequence
Deep sequencing
151286 reads, 95.7 reads per million, 469 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr13: 112233283-112233390 [-]
intergenic
Database links

Mature sequence rno-miR-205

Accession MIMAT0000878
Sequence

33 - 

uccuucauuccaccggagucugu

 - 55

Get sequence
Deep sequencing150151 reads, 469 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).