Stem-loop sequence rno-mir-203a

AccessionMI0000945 (change log)
Previous IDsrno-mir-203
DescriptionRattus norvegicus miR-203a stem-loop
Gene family MIPF0000108; mir-203
Literature search

31 open access papers mention rno-mir-203a
(224 sentences)

Stem-loop
   -------------       u    c         u    g    a     - ug 
5'              gcgcgcc gguc agugguucu aaca uuca caguu c  u
                ||||||| |||| ||||||||| |||| |||| ||||| |   
3'              cgcgcgg ccag ucaccagga uugu aagu guuaa g  a
   agcggcgacggca       c    a         u    a    -     c cg 
Get sequence
Deep sequencing
492557 reads, 440 reads per million, 503 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 136704961-136705057 [+]
antisense
ENSRNOT00000053612 ; Mir3545-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-203a
rno-mir-203bchr6: 136704947-136705061 [-]
rno-mir-203achr6: 136704961-136705057 [+]
Database links

Mature sequence rno-miR-203a-5p

Accession MIMAT0017153
Previous IDsrno-miR-203*
Sequence

14 - 

agugguucuuaacaguucaac

 - 34

Get sequence
Deep sequencing525 reads, 175 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-203a-3p

Accession MIMAT0000876
Previous IDsrno-miR-203
Sequence

52 - 

gugaaauguuuaggaccacuag

 - 73

Get sequence
Deep sequencing492015 reads, 503 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).