Stem-loop sequence rno-mir-200b

Accession MI0000944
Description Rattus norvegicus miR-200b stem-loop
Gene family MIPF0000019; mir-8
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ccaacuu    ag    g c    -    ug     c      u gug 
       gggc  ccgu g cauc uuac  ggcag auugga a   u
       ||||  |||| | |||| ||||  ||||| |||||| |    
       cccg  ggcg c guag aaug  ccguc uaaucu u   c
-gcacgu    -a    g a    u    gu     a      c agu 
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
5: 172898998-172899092 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-200b
rno-mir-200b 5: 172898998-172899092 [-]
rno-mir-200a 5: 172898220-172898308 [-]
rno-mir-3548 5: 172898207-172898326 [+]
rno-mir-429 5: 172897185-172897269 [-]
Database links

Mature sequence rno-miR-200b-5p

Accession MIMAT0017152
Previous IDs rno-miR-200b*
Sequence

21 - 

caucuuacugggcagcauugga

 - 42

Get sequence
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-200b-3p

Accession MIMAT0000875
Previous IDs rno-miR-200b
Sequence

57 - 

uaauacugccugguaaugaugac

 - 79

Get sequence
Evidence experimental; cloned [1], SOLiD [2]
Validated targets
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).