Stem-loop sequence rno-mir-200b

AccessionMI0000944 (change log)
DescriptionRattus norvegicus miR-200b stem-loop
Gene family MIPF0000019; mir-8
Literature search

67 open access papers mention rno-mir-200b
(331 sentences)

Stem-loop
   ccaacuu    ag    g c    -    ug     c      u gug 
5'        gggc  ccgu g cauc uuac  ggcag auugga a   u
          ||||  |||| | |||| ||||  ||||| |||||| |    
3'        cccg  ggcg c guag aaug  ccguc uaaucu u   c
   -gcacgu    -a    g a    u    gu     a      c agu 
Get sequence
Deep sequencing
1302817 reads, 1.18e+03 reads per million, 470 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr5: 173490144-173490238 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-200b
rno-mir-200bchr5: 173490144-173490238 [-]
rno-mir-200achr5: 173489366-173489454 [-]
rno-mir-3548chr5: 173489353-173489472 [+]
rno-mir-429chr5: 173488331-173488415 [-]
Database links

Mature sequence rno-miR-200b-5p

Accession MIMAT0017152
Previous IDsrno-miR-200b*
Sequence

21 - 

caucuuacugggcagcauugga

 - 42

Get sequence
Deep sequencing9534 reads, 262 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-200b-3p

Accession MIMAT0000875
Previous IDsrno-miR-200b
Sequence

57 - 

uaauacugccugguaaugaugac

 - 79

Get sequence
Deep sequencing1293276 reads, 470 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).