Stem-loop sequence rno-mir-200a

AccessionMI0000943 (change log)
DescriptionRattus norvegicus miR-200a stem-loop
Gene family MIPF0000019; mir-8
Literature search

67 open access papers mention rno-mir-200a
(493 sentences)

Stem-loop
   cu   - c   g        -             c    uu  uu 
5'   ggg c ucu ugggcauc uuaccggacagug ugga  uc  g
     ||| | ||| |||||||| ||||||||||||| ||||  ||  g
3'   ccc g gga acuuguag aauggucugucac aucu  ag  c
   -a   a u   a        c             a    -c  uu 
Get sequence
Deep sequencing
1452778 reads, 1.64e+03 reads per million, 485 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr5: 173489366-173489454 [-]
antisense
ENSRNOT00000053773 ; Mir3548-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-200a
rno-mir-200bchr5: 173490144-173490238 [-]
rno-mir-200achr5: 173489366-173489454 [-]
rno-mir-3548chr5: 173489353-173489472 [+]
rno-mir-429chr5: 173488331-173488415 [-]
Database links

Mature sequence rno-miR-200a-5p

Accession MIMAT0017151
Previous IDsrno-miR-200a*
Sequence

16 - 

caucuuaccggacagugcugg

 - 36

Get sequence
Deep sequencing22977 reads, 297 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-200a-3p

Accession MIMAT0000874
Previous IDsrno-miR-200a
Sequence

54 - 

uaacacugucugguaacgaugu

 - 75

Get sequence
Deep sequencing1428279 reads, 484 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).