Stem-loop sequence rno-mir-200c

AccessionMI0000942 (change log)
DescriptionRattus norvegicus miR-200c stem-loop
Gene family MIPF0000019; mir-8
Literature search

64 open access papers mention rno-mir-200c
(415 sentences)

Stem-loop
     cu    -      a        u   u   gg 
5' cc  cguc uuaccc gcaguguu ggg gcu  u
   ||  |||| |||||| |||||||| ||| |||  u
3' gg  guag aauggg cgucauaa cuc uga  g
     ag    u      c        u   -   gg 
Get sequence
Deep sequencing
296693 reads, 254 reads per million, 442 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr4: 157236786-157236854 [-]
antisense
ENSRNOT00000053710 ; Mir3575-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-200c
rno-mir-200cchr4: 157236786-157236854 [-]
rno-mir-3575chr4: 157236759-157236873 [+]
rno-mir-141chr4: 157236346-157236439 [-]
Database links

Mature sequence rno-miR-200c-5p

Accession MIMAT0017150
Previous IDsrno-miR-200c*
Sequence

5 - 

cgucuuacccagcaguguuug

 - 25

Get sequence
Deep sequencing526 reads, 142 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-200c-3p

Accession MIMAT0000873
Previous IDsrno-miR-200c
Sequence

45 - 

uaauacugccggguaaugaug

 - 65

Get sequence
Deep sequencing296119 reads, 442 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).