Stem-loop sequence rno-mir-199a

AccessionMI0000941 (change log)
DescriptionRattus norvegicus miR-199a stem-loop
Gene family MIPF0000040; mir-199
Literature search

67 open access papers mention rno-mir-199a
(253 sentences)

Stem-loop
   uggaagcuu    aga    -    c   gcc       u        c   --uca  ac 
5'          cugg   uccu gcuc guc   ccagugu cagacuac ugu     gg  a
            ||||   |||| |||| |||   ||||||| |||||||| |||     ||   
3'          gacc   ggga cggg cag   gguuaca gucugaug aca     cc  a
   -------ac    ---    a    u   auu       c        -   uguug  gu 
Get sequence
Deep sequencing
1537961 reads, 904 reads per million, 491 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr13: 80125487-80125596 [+]
sense
ENSRNOT00000044190 ; rno-mir-199a-201; 3'UTR (exon 1)
antisense
ENSRNOT00000064219 ; Dnm3-204; intron 14
ENSRNOT00000068490 ; Dnm3-201; intron 15
ENSRNOT00000047799 ; Dnm3-202; intron 15
ENSRNOT00000067653 ; Dnm3-203; intron 15
ENSRNOT00000041058 ; Dnm3-205; intron 15
Clustered miRNAs
< 10kb from rno-mir-199a
rno-mir-199achr13: 80125487-80125596 [+]
rno-mir-214chr13: 80130905-80131014 [+]
rno-mir-3120chr13: 80130909-80131025 [-]
Database links

Mature sequence rno-miR-199a-5p

Accession MIMAT0000872
Previous IDsrno-miR-199a
Sequence

31 - 

cccaguguucagacuaccuguuc

 - 53

Get sequence
Deep sequencing201438 reads, 478 experiments
Evidence experimental; cloned [1], SOLiD [3]
Predicted targets

Mature sequence rno-miR-199a-3p

Accession MIMAT0004738
Sequence

70 - 

acaguagucugcacauugguua

 - 91

Get sequence
Deep sequencing1336503 reads, 489 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).