miRNA Entry for MI0000941

This text is a summary paragraph taken from the Wikipedia entry entitled mir-199_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours.

Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages:

You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages.

Please note, we're not responsible for the content of Wikipedia pages.

You can read more about miRBase, Wikipedia and community annotation on this blog post.

Please email us for help or with comments about this community annotation initiative.

The miR-199 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. (MIPF0000040). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.

mir-199 microRNA precursor

Predicted secondary structure and sequence conservation of mir-199
Identifiers
Symbol	mir-199
Rfam	RF00144
miRBase	MI0000242
miRBase family	MIPF0000040
Other data
RNA type	Gene; miRNA
Domain(s)	Eukaryota
GO	0035195 0035068
SO	0001244

The miR-199 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. ^[1] ^[2] ^[3] (MIPF0000040). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.^[4]

1 Targets of miR-199
2 Expression patterns of miR-199
3 Clinical relevance of miR-199
4 References
5 Further reading
6 External links

[edit] Targets of miR-199

Using microarray and immunoblotting analyses it has been shown that miR-199a* targets the Met proto-oncogene.^[5]

MicroRNA hsa-miR-199a is a regulator of IκB kinase-β (IKKβ) expression.^[6]

[edit] Expression patterns of miR-199

Using TaqMan real-time quantitative PCR array methods, miRNA expression has been profiled. miR-199a, one of the most significantly overexpressed in invasive squamous cell carcinomas (ISCCs), was evaluated by transfecting cervical cancer cells (SiHa and ME-180) with anti-miR-199a oligonucleotides and the cell viability assessed. mirR-199a*, mir199a and mirR-199b were significantly overexpressed in ISCCs.^[7]

Comparative miRNA array led to the isolation of several Bone Morphogenic Protein 2 (BMP2)-responsive miRNAs. Among them, miR-199a* is of particular interest, because it was reported to be specifically expressed in the skeletal system.^[8]

[edit] Clinical relevance of miR-199

Alcoholic liver disease is a common medical consequence of chronic alcohol abuse. Activation of hypoxia-Inducible Factor-1α (HIF-1α) is an indicator of hypoxia. Endothelin-1 (ET-1) is a protein that constricts blood vessels and raises blood pressure. It has been shown that ethanol-induced miR-199 down-regulation may contribute to augmented HIF-1α and ET-1 expression.^[9]

[edit] References

^ Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T (2003). "New microRNAs from mouse and human". RNA 9 (2): 175–9. doi:10.1261/rna.2146903. PMC 1370382. PMID 12554859. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1370382.
^ Houbaviy HB, Murray MF, Sharp PA (2003). "Embryonic stem cell-specific MicroRNAs". Dev. Cell 5 (2): 351–8. doi:10.1016/S1534-5807(03)00227-2. PMID 12919684.
^ Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G (2003). "Numerous microRNPs in neuronal cells containing novel microRNAs". RNA 9 (2): 180–6. doi:10.1261/rna.2141503. PMC 1370383. PMID 12554860. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1370383.
^ Ambros V (2001). "microRNAs: tiny regulators with great potential". Cell 107 (7): 823–6. doi:10.1016/S0092-8674(01)00616-X. PMID 11779458.
^ Kim S, Lee UJ, Kim MN, et al. (June 2008). "MicroRNA miR-199a* regulates the MET proto-oncogene and the downstream extracellular signal-regulated kinase 2 (ERK2)". J. Biol. Chem. 283 (26): 18158–66. doi:10.1074/jbc.M800186200. PMID 18456660.
^ Chen R, Alvero AB, Silasi DA, Kelly MG, Fest S, Visintin I, Leiser A, Schwartz PE, Rutherford T, Mor G (August 2008). "Regulation of IKKbeta by miR-199a affects NF-kappaB activity in ovarian cancer cells.". Oncogene 27 (34): 4712–4723. doi:10.1038/onc.2008.112. PMC 3041589. PMID 18408758. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3041589.
^ Lee JW, Choi CH, Choi JJ, Park YA, Kim SJ, Hwant SY, Kim WY, Kim TJ, Lee JH, Kim BG, Bae DS (2008). "Altered MicroRNA Expression in Cervical Carcinomas". Clin. Cancer Res. 14 (9): 2535–2542. doi:10.1158/1078-0432.CCR-07-1231. PMID 18451214.
^ Lin EA, Kong L, Bai XH, Luan Y, Liu CJ (2009). "miR-199a, a bone morphogenic protein 2-responsive MicroRNA, regulates chondrogenesis via direct targeting to Smad1.". J. Biol. Chem. 284 (17): 11326–11335. doi:10.1074/jbc.M807709200. PMC 2670138. PMID 19251704. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2670138.
^ Yeligar S, Tsukamoto H, Kalra VK (2009). "Ethanol-induced expression of ET-1 and ET-BR in liver sinusoidal endothelial cells and human endothelial cells involves hypoxia-inducible factor-1alpha and microrNA-199". J. Immunol. 183 (8): 5232–43. doi:10.4049/jimmunol.0901084. PMID 19783678.

[edit] Further reading

Kalscheuer S, Zhang X, Zeng Y, Upadhyaya P (December 2008). "Differential expression of microRNAs in early-stage neoplastic transformation in the lungs of F344 rats chronically treated with the tobacco carcinogen 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone". Carcinogenesis 29 (12): 2394–9. doi:10.1093/carcin/bgn209. PMC 2722864. PMID 18780894. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2722864.
Shen Q, Cicinnati VR, Zhang X, et al. (2010). "Role of microRNA-199a-5p and discoidin domain receptor 1 in human hepatocellular carcinoma invasion". Mol. Cancer 9 (1): 227. doi:10.1186/1476-4598-9-227. PMC 2939569. PMID 20799954. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2939569.
Zhang GL, Li YX, Zheng SQ, Liu M, Li X, Tang H (August 2010). "Suppression of hepatitis B virus replication by microRNA-199a-3p and microRNA-210". Antiviral Res 88 (2): 169–75. doi:10.1016/j.antiviral.2010.08.008. PMID 20728471.
Fornari F, Milazzo M, Chieco P, et al. (June 2010). "MiR-199a-3p regulates mTOR and c-Met to influence the doxorubicin sensitivity of human hepatocarcinoma cells". Cancer Res. 70 (12): 5184–93. doi:10.1158/0008-5472.CAN-10-0145. PMID 20501828.

[edit] External links

v t e miRNA precursor families

1-100	1 · 2 · 6 · 7 · 8/141/200 · 9/79 · 10 · 15 · 16 · 17 · 19 · 21 · 22 · 24 · 26 · 29 · 30 · 31 · 33 · 34 · 46/47/281 · 92 · 96

101-200	101 · 103/107 · 122 · 124 · 126 · 127 · 129 · 130 · 132 · 133 · 134 · 135 · 137 · 138 · 143 · 144 · 145 · 146 · 148/152 · 150 · 155 · 156 · 160 · 166 · 172 · 181 · 184 · 191 · 192/215 · 194 · 196 · 199 · 200

201+	203 · 205 · 208 · 210 · 214 · 218 · 219 · 221 · 223 · 224 · 296 · 338 · 395 · 399 · 433 · 451

Other	BART1 · BART2 · BHRF1-1 · BHRF1-2 · BHRF1-3 · Let-7 · Lin-4

Mature sequence rno-miR-199a-5p
Accession	MIMAT0000872
Previous IDs	rno-miR-199a
Sequence	31 - cccaguguucagacuaccuguuc - 53 Get sequence
Evidence	experimental; cloned [1], SOLiD [3]
Predicted targets	MICRORNA.ORG:rno-miR-199a-5p MIRDB:rno-miR-199a-5p TARGETSCAN-VERT:rno-miR-199a-5p

Mature sequence rno-miR-199a-3p
Accession	MIMAT0004738
Sequence	70 - acaguagucugcacauugguua - 91 Get sequence
Evidence	experimental; cloned [2], SOLiD [3]
Predicted targets	MICRORNA.ORG:rno-miR-199a-3p MIRDB:rno-miR-199a-3p TARGETSCAN-VERT:rno-miR-199a-3p

References
1	PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
2	PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3	PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).

miRBase

Stem-loop sequence rno-mir-199a

Contents

[edit] Targets of miR-199

[edit] Expression patterns of miR-199

[edit] Clinical relevance of miR-199

[edit] References

[edit] Further reading

[edit] External links

Mature sequence rno-miR-199a-5p

Mature sequence rno-miR-199a-3p

References