Stem-loop sequence rno-mir-199a

AccessionMI0000941 (change log)
DescriptionRattus norvegicus miR-199a stem-loop
Gene family MIPF0000040; mir-199
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-199_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-199 microRNA precursor is a short non-coding RNA gene involved in gene regulation. miR-199 genes have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   uggaagcuu    aga    -    c   gcc       u        c   --uca  ac 
5'          cugg   uccu gcuc guc   ccagugu cagacuac ugu     gg  a
            ||||   |||| |||| |||   ||||||| |||||||| |||     ||   
3'          gacc   ggga cggg cag   gguuaca gucugaug aca     cc  a
   -------ac    ---    a    u   auu       c        -   uguug  gu 
Get sequence
Deep sequencing
81990 reads, 784 reads per million, 38 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr13: 80125487-80125596 [+]
sense
ENSRNOT00000044190 ; rno-mir-199a-201; 3'UTR (exon 1)
antisense
ENSRNOT00000064219 ; Dnm3-204; intron 14
ENSRNOT00000068490 ; Dnm3-201; intron 15
ENSRNOT00000047799 ; Dnm3-202; intron 15
ENSRNOT00000067653 ; Dnm3-203; intron 15
ENSRNOT00000041058 ; Dnm3-205; intron 15
Clustered miRNAs
< 10kb from rno-mir-199a
rno-mir-199achr13: 80125487-80125596 [+]
rno-mir-214chr13: 80130905-80131014 [+]
rno-mir-3120chr13: 80130909-80131025 [-]
Database links

Mature sequence rno-miR-199a-5p

Accession MIMAT0000872
Previous IDsrno-miR-199a
Sequence

31 - 

cccaguguucagacuaccuguuc

 - 53

Get sequence
Deep sequencing10026 reads, 38 experiments
Evidence experimental; cloned [1], SOLiD [3]
Predicted targets

Mature sequence rno-miR-199a-3p

Accession MIMAT0004738
Sequence

70 - 

acaguagucugcacauugguua

 - 91

Get sequence
Deep sequencing71963 reads, 38 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).