Stem-loop sequence rno-mir-196a

Accession MI0000940
Previous IDs rno-mir-196
Description Rattus norvegicus miR-196a stem-loop
Gene family MIPF0000031; mir-196
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-196_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-196 is a non-coding RNA called a microRNA that has been shown to be expressed in human (MI0000238, MI0000279) and mouse (MI0000552, MI0000553). miR-196 appears to be a vertebrate specific microRNA and has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000031). In many species the miRNA appears to be expressed from intergenic regions in HOX gene clusters. The hairpin precursors are predicted based on base pairing and cross-species conservation—their extents are not known. In this case the mature sequence is excised from the 5' arm of the hairpin. It has been suggested that a rare SNP (rs11614913) that overlaps hsa-mir-196a2 has been found to be associated with non-small cell lung carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-------uguuugcuca     uc                  a          a ug   
                 gcuga  uguggcuuagguaguuuc uguuguuggg u  ag 
                 |||||  |||||||||||||||||| |||||||||| |  | u
                 ugacu  acauugaguccgucaaag acaacggcuc a  uu 
cgggagcugcuuuuggc     --                  a          a gu   
Get sequence
Comments

Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (RGSC3.4) Overlapping transcripts
7: 141736759-141736868 [+]
intergenic
Database links

Mature sequence rno-miR-196a-5p

Accession MIMAT0000871
Previous IDs rno-miR-196a
Sequence

25 - 

uagguaguuucauguuguuggg

 - 46

Get sequence
Evidence experimental; cloned [1,3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-196a-3p

Accession MIMAT0004737
Previous IDs rno-miR-196a*
Sequence

61 - 

ucggcaacaagaaacugccuga

 - 82

Get sequence
Evidence experimental; cloned [3], SOLiD [4]
Predicted targets

References

1
2
PMID:15105502 "MicroRNA-directed cleavage of HOXB8 mRNA" Yekta S, Shih IH, Bartel DP Science. 304:594-596(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).