Stem-loop sequence rno-mir-196a

AccessionMI0000940 (change log)
Previous IDsrno-mir-196
DescriptionRattus norvegicus miR-196a stem-loop
Gene family MIPF0000031; mir-196
Literature search

11 open access papers mention rno-mir-196a
(22 sentences)

Stem-loop
   -------uguuugcuca     uc                  a          a ug   
5'                  gcuga  uguggcuuagguaguuuc uguuguuggg u  ag 
                    |||||  |||||||||||||||||| |||||||||| |  | u
3'                  ugacu  acauugaguccgucaaag acaacggcuc a  uu 
   cgggagcugcuuuuggc     --                  a          a gu   
Get sequence
Deep sequencing
244325 reads, 169 reads per million, 402 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr7: 144584235-144584344 [+]
intergenic
Database links

Mature sequence rno-miR-196a-5p

Accession MIMAT0000871
Previous IDsrno-miR-196a
Sequence

25 - 

uagguaguuucauguuguuggg

 - 46

Get sequence
Deep sequencing242105 reads, 401 experiments
Evidence experimental; cloned [1,3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-196a-3p

Accession MIMAT0004737
Previous IDsrno-miR-196a*
Sequence

61 - 

ucggcaacaagaaacugccuga

 - 82

Get sequence
Deep sequencing2013 reads, 154 experiments
Evidence experimental; cloned [3], SOLiD [4]
Predicted targets

References

1
2
PMID:15105502 "MicroRNA-directed cleavage of HOXB8 mRNA" Yekta S, Shih IH, Bartel DP Science. 304:594-596(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).