Stem-loop sequence rno-mir-195

AccessionMI0000939 (change log)
DescriptionRattus norvegicus miR-195 stem-loop
Gene family MIPF0000006; mir-15
Literature search

49 open access papers mention rno-mir-195
(241 sentences)

Stem-loop
   a   cu    g  cu          -a          c  g a 
5'  acu  ccug cu  agcagcacag  aauauuggca gg u a
    |||  |||| ||  ||||||||||  |||||||||| || | g
3'  ugg  ggac ga  ucgucguguc  uuauaaccgu cu a u
   g   ug    g  cc          gg          -  g g 
Get sequence
Deep sequencing
393667 reads, 265 reads per million, 491 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 56845301-56845387 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-195
rno-mir-497chr10: 56844977-56845045 [+]
rno-mir-195chr10: 56845301-56845387 [+]
Database links

Mature sequence rno-miR-195-5p

Accession MIMAT0000870
Previous IDsrno-miR-195
Sequence

15 - 

uagcagcacagaaauauuggc

 - 35

Get sequence
Deep sequencing374623 reads, 487 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-195-3p

Accession MIMAT0017149
Previous IDsrno-miR-195*
Sequence

53 - 

ccaauauuggcugugcugcucca

 - 75

Get sequence
Deep sequencing18840 reads, 453 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).