Stem-loop sequence rno-mir-194-2

AccessionMI0000938 (change log)
DescriptionRattus norvegicus miR-194-2 stem-loop
Gene family MIPF0000055; mir-194
Literature search

21 open access papers mention rno-mir-194-2
(131 sentences)

Stem-loop
   -u   uc       cu         acuccauguggaagugc 
5'   ggc  ccacccc  guaacagca                 c
     |||  |||||||  |||||||||                  
3'   ucg  ggugggg  uauugucgu                 c
   gg   ga       uc         cggggugaccuuaguca 
Get sequence
Deep sequencing
2559335 reads, 2.44e+03 reads per million, 501 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 221634786-221634870 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-194-2
rno-mir-194-2chr1: 221634786-221634870 [+]
rno-mir-192chr1: 221634971-221635080 [+]
Database links

Mature sequence rno-miR-194-5p

Accession MIMAT0000869
Previous IDsrno-miR-194
Sequence

15 - 

uguaacagcaacuccaugugga

 - 36

Get sequence
Deep sequencing5106761 reads, 501 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-194-3p

Accession MIMAT0017148
Previous IDsrno-miR-194*
Sequence

51 - 

ccaguggggcugcuguuaucu

 - 71

Get sequence
Deep sequencing7052 reads, 301 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).