Stem-loop sequence rno-mir-194-2

AccessionMI0000938 (change log)
DescriptionRattus norvegicus miR-194-2 stem-loop
Gene family MIPF0000055; mir-194
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-194_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-194 microRNA precursor is a small non-coding RNA gene that regulated gene expression. Its expression has been verified in mouse (MI0000236, MI0000733) and in human (MI0000488, MI0000732). mir-194 appears to be a vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000055). The mature microRNA is processed from the longer hairpin precursor by the Dicer enzyme. In this case, the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -u   uc       cu         acuccauguggaagugc 
5'   ggc  ccacccc  guaacagca                 c
     |||  |||||||  |||||||||                  
3'   ucg  ggugggg  uauugucgu                 c
   gg   ga       uc         cggggugaccuuaguca 
Get sequence
Deep sequencing
272673 reads, 2.14e+03 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 221634786-221634870 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-194-2
rno-mir-194-2chr1: 221634786-221634870 [+]
rno-mir-192chr1: 221634971-221635080 [+]
Database links

Mature sequence rno-miR-194-5p

Accession MIMAT0000869
Previous IDsrno-miR-194
Sequence

15 - 

uguaacagcaacuccaugugga

 - 36

Get sequence
Deep sequencing544369 reads, 39 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-194-3p

Accession MIMAT0017148
Previous IDsrno-miR-194*
Sequence

51 - 

ccaguggggcugcuguuaucu

 - 71

Get sequence
Deep sequencing787 reads, 21 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).