Stem-loop sequence rno-mir-194-1

AccessionMI0000937 (change log)
DescriptionRattus norvegicus miR-194-1 stem-loop
Gene family MIPF0000055; mir-194
Literature search

22 open access papers mention rno-mir-194-1
(131 sentences)

Stem-loop
   a     -      cgu         a      gu   -   u 
5'  uggag ucauca   guaacagca cuccau  gga cug g
    ||||| ||||||   ||||||||| ||||||  ||| |||  
3'  accuc gguagu   cauugucgu gaggug  ccu gac c
   -     c      uuu         c      ac   a   a 
Get sequence
Deep sequencing
2561188 reads, 2.45e+03 reads per million, 501 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr13: 103250576-103250658 [+]
intergenic
Database links

Mature sequence rno-miR-194-5p

Accession MIMAT0000869
Previous IDsrno-miR-194
Sequence

15 - 

uguaacagcaacuccaugugga

 - 36

Get sequence
Deep sequencing5106761 reads, 501 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).