Stem-loop sequence rno-mir-193a

AccessionMI0000936 (change log)
Previous IDsrno-mir-193
DescriptionRattus norvegicus miR-193 stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
   gcggac          ag     u     cg   a  a    ggu 
5'       gggagcugag  cuggg cuuug  ggc ag ugag   g
         ||||||||||  ||||| |||||  ||| || ||||    
3'       cccucggcuc  gaccc gaaac  ccg uc acuu   u
   ------          cu     u     au   g  a    gac 
Get sequence
Deep sequencing
5358 reads, 39.5 reads per million, 38 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 67065896-67065981 [+]
antisense
ENSRNOT00000053781 ; Mir3549-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-193a
rno-mir-3549chr10: 67065885-67065996 [-]
rno-mir-193achr10: 67065896-67065981 [+]
Database links

Mature sequence rno-miR-193a-5p

Accession MIMAT0004736
Previous IDsrno-miR-193-5p
Sequence

20 - 

ugggucuuugcgggcaagauga

 - 41

Get sequence
Deep sequencing73 reads, 21 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-193a-3p

Accession MIMAT0000868
Previous IDsrno-miR-193-3p
Sequence

54 - 

aacuggccuacaaagucccagu

 - 75

Get sequence
Deep sequencing5281 reads, 38 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).