Stem-loop sequence rno-mir-192

AccessionMI0000935 (change log)
DescriptionRattus norvegicus miR-192 stem-loop
Gene family MIPF0000063; mir-192
Literature search

35 open access papers mention rno-mir-192
(190 sentences)

Stem-loop
   -gucaaga  ga   c   g g  c         -     a       uacuc  a 
5'         ug  gug aca g cu ugaccuaug aauug cagccag     ug u
           ||  ||| ||| | || ||||||||| ||||| |||||||     ||  
3'         ac  cgc ugu u ga acuggauac uugac gucgguc     gc c
   cgaccgua  uc   u   a g  c         c     c       --ucc  u 
Get sequence
Deep sequencing
42730122 reads, 4.21e+04 reads per million, 508 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 221634971-221635080 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-192
rno-mir-194-2chr1: 221634786-221634870 [+]
rno-mir-192chr1: 221634971-221635080 [+]
Database links

Mature sequence rno-miR-192-5p

Accession MIMAT0000867
Previous IDsrno-miR-192
Sequence

24 - 

cugaccuaugaauugacagcc

 - 44

Get sequence
Deep sequencing42705016 reads, 508 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-192-3p

Accession MIMAT0017147
Previous IDsrno-miR-192*
Sequence

67 - 

cugccaguuccauaggucacag

 - 88

Get sequence
Deep sequencing10969 reads, 320 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).