Stem-loop sequence rno-mir-191a

AccessionMI0000934 (change log)
Previous IDsrno-mir-191
DescriptionRattus norvegicus miR-191a stem-loop
Gene family MIPF0000194; mir-191
Literature search

24 open access papers mention rno-mir-191a
(56 sentences)

Stem-loop
   -   u   c      c          c  aa       uu  -  c 
5'  ggc gga agcggg aacggaaucc aa  gcagcug  gu cu c
    ||| ||| |||||| |||||||||| ||  |||||||  || ||  
3'  ccg ccu ucgucc uugcuuuagg uu  cgucgac  ua ga a
   u   u   c      c          -  ca       cu  c  g 
Get sequence
Deep sequencing
14637440 reads, 1.36e+04 reads per million, 510 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr8: 117354364-117354454 [+]
antisense
ENSRNOT00000053579 ; Mir3555-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-191a
rno-mir-191bchr8: 117354348-117354467 [-]
rno-mir-191achr8: 117354364-117354454 [+]
rno-mir-425chr8: 117354821-117354903 [+]
Database links

Mature sequence rno-miR-191a-5p

Accession MIMAT0000866
Previous IDsrno-miR-191
Sequence

15 - 

caacggaaucccaaaagcagcug

 - 37

Get sequence
Deep sequencing14626000 reads, 510 experiments
Evidence experimental; cloned [1-4], Northern [1,3], SOLiD [5]
Predicted targets

Mature sequence rno-miR-191a-3p

Accession MIMAT0017146
Previous IDsrno-miR-191*
Sequence

57 - 

gcugcacuuggauuucguuccc

 - 78

Get sequence
Deep sequencing11422 reads, 475 experiments
Evidence experimental; SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).