Stem-loop sequence rno-mir-191a

AccessionMI0000934 (change log)
Previous IDsrno-mir-191
DescriptionRattus norvegicus miR-191a stem-loop
Gene family MIPF0000194; mir-191
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-191. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-191 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-191 has been found to be dysregulated in a large number of different types of human tumour, including those of colorectal, breast and prostate cancers. Despite these cancer links, target genes of the mature miRNA have not been characterised, and it is not known which factors lead to its dysregulation in certain tumour cells. The expression profile of miR-191 could be implemented in prognosis of acute myeloid leukaemia, with higher than average levels of miR-191 suggesting a lower survival probability.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -   u   c      c          c  aa       uu  -  c 
5'  ggc gga agcggg aacggaaucc aa  gcagcug  gu cu c
    ||| ||| |||||| |||||||||| ||  |||||||  || ||  
3'  ccg ccu ucgucc uugcuuuagg uu  cgucgac  ua ga a
   u   u   c      c          -  ca       cu  c  g 
Get sequence
Deep sequencing
1281864 reads, 1.04e+04 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr8: 117354364-117354454 [+]
antisense
ENSRNOT00000053579 ; Mir3555-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-191a
rno-mir-191bchr8: 117354348-117354467 [-]
rno-mir-191achr8: 117354364-117354454 [+]
rno-mir-425chr8: 117354821-117354903 [+]
Database links

Mature sequence rno-miR-191a-5p

Accession MIMAT0000866
Previous IDsrno-miR-191
Sequence

15 - 

caacggaaucccaaaagcagcug

 - 37

Get sequence
Deep sequencing1281076 reads, 39 experiments
Evidence experimental; cloned [1-4], Northern [1,3], SOLiD [5]
Predicted targets

Mature sequence rno-miR-191a-3p

Accession MIMAT0017146
Previous IDsrno-miR-191*
Sequence

57 - 

gcugcacuuggauuucguuccc

 - 78

Get sequence
Deep sequencing787 reads, 38 experiments
Evidence experimental; SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).